Search Strains

More Fields
Strain Species Genotype Add
BC119 C. elegans blmp-1(s71) I. Show Description
Dpy.
CF1407 C. elegans daf-16(mu86) I; muIs71 X. Show Description
muIs71 [(pKL99) daf-16ap::GFP::daf-16a(bKO)) + rol-6(su1006)]. Grows okay at 20C. Spontaneous integrant. Rollers.
GR1333 C. elegans yzIs71 V. Show Description
yzIs71 [tph-1p::GFP + rol-6(su1006)] V. Rollers. tph-1 transcriptional reporter containing 3.1kb of tph-1 5’ regulatory sequence through the beginning of exon 4. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. Sze JY, et al. Nature. 2000 Feb 3;403(6769):560-4.
JK1534 C. elegans ces-1(n703) qDf5/unc-29(e193) mec-8(e398) blmp-1(s71) I. Show Description
Heterozygotes are Ces and grow slowly. Hets segregate DpyUncs and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC.
JM149 C. elegans caIs71. Show Description
caIs71[elt-2p::GFP::HIS-2B::unc-54 3'UTR + rol-6(su1006)]. Rollers. Expresses nuclear-localized GFP in all intestinal nuclei under control of 5.2 kb elt-2 promoter. GFP is fused to Histone H2B + (fused pie-1 and truncated unc-54 3'-UTR). Transgene was integrated into N2 background by exposure to gamma rays. Reference: Dineen A, et al. Dev Biol. 2018 Mar 15;435(2):150-161. PMID: 29360433
JS71 C. elegans dpy-11(e224) air-1(vw5) V/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Dpy Stu, Unc-36 (eT1 homozygotes) and dead eggs. Also weak Him.
MAH677 C. elegans sid-1(qt9) V; sqIs71. Show Description
sqIs71 [rgef-1p::GFP + rgef-1p::sid-1]. Pan-neuronal expression of sid-1 driven by the rgef-1 promoter. Expression remains neuron-specific until at least Day 10. Animals respond to feeding RNAi against gfp and neuronal genes snb-1 and unc-13. In contrast, animals are resistant to phenotypes induced by feeding RNAi constructs targeting non-neuronal genes pept-1, unc-112, bli-1 and die-1. Reference: Yang Y, et al. Nat Aging 2024 Jan 4. doi: 10.1038/s43587-023-00548-1. PMID: 38177330. MAH677 effectively replaces strain TU3401 sid-1(pk3321) uIs69 [pCFJ90 (myo-2p::mCherry) + unc-119p::sid-1] V., which was found to show RNAi response in non-neuronal tissues.
MSB778 C elegans mirIs71. Show Description
mirIs71 [nlp-12p::CRE + myo-2p::mCherry]. DVA-specific CRE driver. Superficially wild-type. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987
SM1017 C. elegans tlf-1(ok389)/unc-55(e402) blmp-1(s71) I. Show Description
Heterozygotes are wild type and segregate wild type, Dpy Uncs, and arrested early larva (L1s). Pick WT to maintain.
SP1478 C. elegans unc-29(e193) blmp-1(s71) I. Show Description
DpyUnc.
TU3403 C. elegans ccIs4251 I; sid-1(qt2) V; uIs71. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. uIs71 [(pCFJ90) myo-2p::mCherry + mec-18p::sid-1]. TRN-specific feeding RNAi. Reference: Calixto et al. (2010) Nature Methods 7:554-9.
TU3568 C. elegans sid-1(pk3321) him-5(e1490) V; lin-15B(n744) X; uIs71. Show Description
uIs71 [(pCFJ90) myo-2p::mCherry + mec-18p::sid-1]. TRN-specific RNAi by feeding. Him (~50% males). Maintain 15-20 degrees. Reference: Calixto et al. (2010) Nature Methods 7:554-9.
OH15655 C. elegans otIs711. Show Description
otIs711 [nlp-8p::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
OP710 C. elegans unc-119(tm4063) III; wgIs710. Show Description
wgIs710 [F21A10.2::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
OP711 C. elegans unc-119(tm4063) III; wgIs711. Show Description
wgIs711 [fkh-7::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
OP712 C. elegans unc-119(tm4063) III; wgIs712. Show Description
wgIs712 [hlh-2::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
OP713 C. elegans unc-119(tm4063) III; wgIs713. Show Description
wgIs713 [T11G6.8::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
OP714 C. elegans unc-119(tm4063) III; wgIs714. Show Description
wgIs714 [B0336.7::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
OP715 C. elegans unc-119(tm4063) III; wgIs715. Show Description
wgIs715 [tbx-36::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
OP717 C. elegans unc-119(tm4063) III; wgIs717. Show Description
wgIs717 [K04C1.3::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
OP719 C. elegans unc-119(tm4063) III; wgIs719. Show Description
wgIs719 [svh-5::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
PS7107 C. elegans syIs373 I. Show Description
syIs373 [15xUAS::?pes-10::HisCl1::SL2::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)].  Histamine chloride channel cGAL.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7108 C. elegans syIs374 V. Show Description
syIs374 [15xUAS::(delta)pes-10::HisCl1::SL2::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)].  histamine chloride channel cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7127 C. elegans unc-119(ed4) III; syIs360. Show Description
syIs360 [ets-10p::GFP + unc-119(+)]. Dauer decision marker that indicates commitment to dauer formation in neurons and intestine. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7.
PS7136 C. elegans syIs378 I. Show Description
syIs378 [15xUAS::?pes-10::mKate2::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)].  mKate2 cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7149 C. elegans syIs390 X. Show Description
syIs390 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)].  GFP cGAL effector.  Weak background fluorescence in some head neurons and the head mesodermal cell.  [NOTE: (03/18/2020) a user has reported syIs390 does not map to LG X] Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7154 C. elegans syIs391 IV. Show Description
syIs391 [myo-2p::NLS::GAL4SK::VP64::unc-54 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)].  myo-2 cGAL driver for pharyngeal muscle.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7155 C. elegans syIs392. Show Description
syIs392 [unc-17p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for Cholinergic neurons. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7160 C. elegans syIs393 IV. Show Description
syIs393 [unc-47p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP +  pBlueScript].  unc-47 cGAL driver for GABAergic neurons.  Relatively weak expression. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7167 C. elegans syIs396 syIs337 III. Show Description
syIs396 [unc-47p::NLS::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)].  syIs337 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)].  syIs396 is unc-47 cGAL driver for GABAergic neurons.  syIs337 is GFP cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7169 C. elegans syIs337 syIs398 III. Show Description
syIs337 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)].  syIs398 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)].  syIs337 is a GFP cGAL effector. syIs398 is hsp-16.41 cGAL driver for heat shock promoter. Bright GFP fluorescence in a few head neurons without heat shock.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7171 C. elegans syIs337 III; syIs400 V. Show Description
syIs337 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] III.  syIs400 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)] V. syIs337 is a GFP cGAL effector. syIs400 is hsp-16.41 cGAL driver for heat shock promoter. Bright GFP fluorescence in a few head neurons without heat shock.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7172 C. elegans syIs337 syIs401 III. Show Description
syIs337 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] III. syIs401 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)].  syIs337 is a GFP cGAL effector. syIs401 is hsp-16.41 cGAL driver for heat shock promoter. Low levels of GFP fluorescence in a few head neurons without heat shock. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7185 C. elegans syIs406 IV. Show Description
syIs406 [15xUAS::?pes-10::GFP::H2B::let-858 3'UTR + ttx-3p::RFP + pBlueScript].  GFP::H2B effector.  Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7186 C. elegans syIs407 V. Show Description
syIs407 [15xUAS::?pes-10::GFP::H2B::let-858 3'UTR + ttx-3p::RFP + pBlueScript].  GFP::H2B cGAL effector.  Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7190 C. elegans syIs409 X. Show Description
syIs409 [15xUAS::?pes-10::mCherry::H2B::let-858 3'UTR + unc-122p::GFP + pBlueScript].  mCherry::H2B cGAL effector.  Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7192 C. elegans syIs413 IV. Show Description
syIs413 [15xUAS::?pes-10::ICE::let-858 3'UTR + unc-122p::GFP + pBlueScript].  Human caspase ICE cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS7199 C. elegans syIs371 III. Show Description
syIs371 [15xUAS::?pes-10::HisCl1::SL2::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)].  Histamine chloride channel cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
PS8849 C. elegans syIs710; syIs300. Show Description
syIs710 [srg-13p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for PHA neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS8872 C. elegans syIs716; syIs300. Show Description
syIs716 [klp-6p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for IL2 neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
SS712 C. elegans ife-1(bn127) III. Show Description
Temperature sensitive sterility. Should be cultured at 15C or 20C. At 25C, spermatocytes fail in cytokinesis and accumulate as multinucleate cells unable to mature to spermatids. Milder defect in oogenesis is not temperature sensitive. Oocyte production is slowed, but appear relatively normal and are fertile. Inefficient translation of several maternal mRNAs (mex-1, oma-1, pos-1, and pal-1). Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 1, germ cell specific, P granule associated; F53A2.6). Homozygous 590 bp deletion starts at nt 191 in exon 1 and extends through exon 2 and into the 3' UTR to nt 780. The deletion removes over 70% of the coding region for IFE-1, including the helices and sheets that make up the mRNA platform and a Trp residue essential for m7GTP cap binding, suggesting it is a null mutation. Deletion breakpoint determined by sequencing by SS is: aagtggcctcaacgcgttgt//tgatgaaaattaattgtatt. The ife-1 gene is the third in an operon, but the deletion is contained completely within the ife-1 gene.
SYS714 C. elegans Y73E7A.1(dev233([Y73E7A.1::mNeonGreen]) I; ujIs113 II. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of Y73E7A.1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
ZM10339 C. elegans hpIs717; ljIs131. Show Description
hpIs717 [acr-2(s)p::LoxP::eBFP::LoxP::Chrimson::wCherry + unc-17p::Cre + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Red fluorescence in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).