Search Strains

More Fields
Strain Species Genotype Add
RW3616 C. elegans deb-1(st554)/unc-5(e53) unc-24(e138) IV. Show Description
Heterozygotes are WT and segregate WT, Uncs and Pats. Maintain by picking WT and checking for correct segregation of progeny. Received new stock from Waterston lab 5/98. st554 previously called pat-8.
RW3562 C. elegans unc-44(e362) deb-1(st555)/unc-82(e1323) unc-24(e138) IV. Show Description
Heterozygotes are WT and segregate WT, Uncs (unc-82 unc-24 homozygotes) and dead eggs (unc-44 deb-1 homozygotes).
NK2478 C. elegans deb-1(qy48[deb-1::mNG + LoxP]) IV. Show Description
CRISPR/Cas9 insertion of mNeonGreen tag into endogenous deb-1 locus. Low penetrance Rup and Pvl. Reference: Park K, et al. eLife. 2023 Jul 5;12:RP87037. doi: 10.7554/eLife.87037. PMID: 37405383.
RG3439 C. elegans deb-1(ve939[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Maintain by picking wild-type GFP+ mKate2+. Deletion of 7456 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead embryos (ve939 homozygotes; embryonic lethal), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Left flanking Sequence: CCATCAGAATGGCCATTCTCTTCGCAGCCG; Right flanking sequence: ttgtaagatttgtacagatttttcgagctt. deb-1 sgRNA A: ACAGGAGAACGATATTGTGG; deb-1 sgRNA B: accatccataagtctcaagg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RSL136 C. elegans deb-1(ftw88[deb-1::mCherry]) IV. Show Description
Endogenous deb-1 locus tagged with mCherry. Bright red fluorescence in all muscles is visible by dissection fluorescence microscopy. Please contact Ryan Littlefield prior to publishing work with this strain.
RSL83 C. elegans deb-1(ftw60[deb-1::GFP]) IV. Show Description
Endogenous locus tagged with GFP using CRISPR/Cas9. Body muscles are visibly green by dissection fluorescence microscopy. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.