| RG5108 |
Y71H2AM.20(gk5290[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. |
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Apparent homozygous lethal or sterile deletion balanced over labeled sC1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+ heterozygotes, GFP+ non-mKate2 gk5290 homozygotes (Let), and Dpy mKate2+ sC1 homozygotes. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4205 and CGC51. gk5290 is a deletion of 2953 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAGATTCGACGACAGATGACGAATGGACGG. Right flanking sequence: CACGGATTCAGGTCGAACACATTTTTAATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG5109 |
sbds-1(gk5584[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. |
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Apparent homozygous lethal or sterile deletion balanced over labeled sC1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+ heterozygotes, GFP+ non-mKate2 gk5584 homozygotes (Let), and Dpy mKate2+ sC1 homozygotes. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4513 and CGC51. gk5584 is a deletion of 1745 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTGAGATCCAAAAAGAATTCTCGGGTGTGT. Right flanking sequence: ATTGGTCAGAACTTTCTGATTTGTCGGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG5110 |
perm-1(gk5785[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Apparent homozygous lethal or sterile deletion balanced over labeled mT1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, GFP+ non-mKate2 gk5627 homozygotes, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4716 and CGC66. gk5785 is a deletion of 1919 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CGGGAAATCTGTTTTAAAAATGTTTGCCCG. Right flanking sequence: TTTTCCAATAATCCAATACCCATTTAATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG5111 |
+/mT1 [umnIs52] II; wah-1(gk5392[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Apparent homozygous lethal or sterile deletion balanced over labeled mT1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, GFP+ non-mKate2 gk5392 homozygotes, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4309 and CGC66. gk5392 is a deletion of 9220 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGTTTACACGCCCACCAATCTTCCCCGCCC. Right flanking sequence: TTCGGACCTTCACTGGATGTAGCTCGGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| MCJ366 |
mir-4812(cdb175) mir-1829b(cdb163) mir-1829c(cdb164) mir-1829a(cbd199) X. |
Deletion allele of each microRNA. For mir-1829a, the entire intron is deleted to minimize disruption of host gene, gas-1. sgRNA #1: CGAGGACTGAAGGAGGAACG; sgRNA #2: GGAGGCGGAAGCTACCTGCG; sgRNA #3: GCGGTAACAGAGAGAACATG; sgRNA #4: GCTTCCTCGTCCTGCCGCCG; sgRNA #5: GTTTTCAAAACAGGGGGAGG; sgRNA #6: GCGACAGCAGAAAGAGCATG; sgRNA #7: GACGCAACCACTTTGGCCAC; sgRNA #8: ACGTGAGCTCTATAACTAAC; sgRNA #9: ATGGAACCGGAAAACCATAT; sgRNA #10: AGTGAGCAAACCCTGGAGCG; sgRNA #11: GCTACCATAGGCACCACGAG. Guide RNAs were injected in three rounds of CRISPR. sgRNAs #7-8 did not result in edits at the mir-1829a locus. sgRNA #11 was for co-CRISPR to mark jackpot founder plates.Reference: Sakhawala R, et al. Genes Dev. 2025 Oct 1;39(19-20):1198-1218. doi: 10.1101/gad.352481.124. PMID: 40659526. |
| MCJ387 |
ieSi57 II; dcr-1(zen79[dcr-1::AID*::3xFLAG]) III; ieSi38 IV. |
AID* degron and 3xFLAG tag inserted at C-terminus of endogenous dcr-1 locus. ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. eSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgenes express modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma, germ line and early embryos. sgRNA #1: CCTCTTCACTTTCTGTGATATGC. Reference: Sakhawala R, et al. Genes Dev. 2025 Oct 1;39(19-20):1198-1218. doi: 10.1101/gad.352481.124. PMID: 40659526. |
| MCJ474 |
gldr-2(cdb217[3xFLAG::AID*::GFP::gldr-2]) I. |
3xFLAG::AID*::GFP degron tag inserted at N-terminus of endogenous gldr-2 locus. sgRNA #1: TTTCTCGACATttctgaaag; sgRNA #2: CACATTCATGGGAACTGAAT; sgRNA #3: GCTACCATAGGCACCACGAG. sgRNA #3 (dpy-10) was used for co-CRISPR to mark jackpot founder plates. Reference: Sakhawala R, et al. Genes Dev. 2025 Oct 1;39(19-20):1198-1218. doi: 10.1101/gad.352481.124. PMID: 40659526. |
| MCJ666 |
ieSi57 II; rpc-1(cdb434[rpc-1::3xFLAG::AID*]) ieSi38 IV. |
3xFLAG tag and AID* degron inserted at C-terminus of endogenous rpc-1 locus. ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. eSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgenes express modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma, germ line and early embryos. Made by CRISPR modification of parental strain MLC1040. sgRNA #1: CGGCGAATTCTGTTTAAGAA; sgRNA #2: GCTACCATAGGCACCACGAG. sgRNA #2 (dpy-10) was used for co-CRISPR to mark jackpot founder plates. Reference: Sakhawala R, et al. Genes Dev. 2025 Oct 1;39(19-20):1198-1218. doi: 10.1101/gad.352481.124. PMID: 40659526. |
| MCJ677 |
nsun-2(cdb460[nsun-2::3xFLAG::AID*]) I; ieSi57 II; ieSi38 IV. |
3xFLAG tag and AID* degron inserted at C-terminus of endogenous nsun-2 locus. ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. eSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgenes express modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma, germ line and early embryos. Made by CRISPR modification of parental strain MLC1040. sgRNA #1: TCCAGAATCTGCTGAAACTC; sgRNA #2: GCTACCATAGGCACCACGAG. sgRNA #2 (dpy-10) was used for co-CRISPR to mark jackpot founder plates. Reference: Sakhawala R, et al. Genes Dev. 2025 Oct 1;39(19-20):1198-1218. doi: 10.1101/gad.352481.124. PMID: 40659526. |
| MCJ133 |
alg-2(cdb12 cdb51[3xFLAG::alg-2]) II. |
3xFLAG tag inserted at N-terminus of short isoform of endogenous alg-2 locus. sgRNA #1: TCGTCTTTCATGCCAGATGG; sgRNA #2: AAGTGCAGACATACTTAAGT; sgRNA #3: GCTACCATAGGCACCACGAG; sgRNA #4: GCTACCATAGGCACCACGAG. sgRNA #4 was used both for co-CRISPR to mark jackpot founder plates and for modification of cdb12, an edit that introduced a site editable by this gRNA. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816. |
| MCJ288 |
alg-2(cdb155[D627A]) II. |
cdb155 is an engineered D627A substitution in the short isoform of alg-2, mutating the DDH catalytic triad to ADH. Catalytically inactive allele of alg-2. sgRNA #1: GATGGGTGATGTCGCAACCC. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816. |
| MCJ511 |
mir-72(cdb223) II; mir-63(cdb218) X. |
Deletion allele of each microRNA with an efficient CRISPR protospacer sequence (TGTATCAGTTCGATATCTGA) inserted at each locus to facilitate subsequent CRISPR modification. sgRNA #1: GTTGCTCCAGGAGCATGGTT; sgRNA #2: CTGAAGCGAGTTGGAAATAG; sgRNA #3: CTGAAGGTCCCGTCAGAGCT; sgRNA #4: CAGGTCCTCACATCAGTGCG; sgRNA #5: GCTACCATAGGCACCACGAG. sgRNA #5 (dpy-10) was used for co-CRISPR to mark jackpot founder plates. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816. |
| MCJ583 |
alg-1(cdb153[D740A]) X. |
cdb153 is an engineered D740A substitution in the short isoform of alg-1, mutating the DDH catalytic triad to ADH. Catalytically inactive allele of alg-1. sgRNA #1: GACATCACTCATCCACCAGC; sgRNA #2: GCTACCATAGGCACCACGAG. sgRNA #2 (dpy-10) was used for co-CRISPR to mark jackpot founder plates. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816. |
| MCJ624 |
alg-1(xk5[3xFLAG::alg-1] cdb358[D740A]) X. |
3xFLAG tag inserted at N-terminus of short isoform of endogenous alg-1 locus. cdb358 is an engineered D740A substitution in the short isoform of alg-1, mutating the DDH catalytic triad to ADH. Catalytically inactive allele of alg-1. sgRNA #1: GACATCACTCATCCACCAGC; sgRNA #2: GCTACCATAGGCACCACGAG. sgRNA #2 (dpy-10) was used for co-CRISPR to mark jackpot founder plates. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816. |
| MCJ639 |
alg-2(cdb12 cdb51[3xFLAG::alg-2] cdb370[D627A]) II. |
3xFLAG tag inserted at N-terminus of short isoform of endogenous alg-2 locus. cdb370 is an engineered D627A substitution in the short isoform of alg-2, mutating the DDH catalytic triad to ADH. Catalytically inactive allele of alg-2. sgRNA #1: GATGGGTGATGTCGCAACCC. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816. |
| QK67 |
alg-1(xk5[3xFLAG::alg-1]) X. |
3xFLAG tag inserted at N-terminus of short isoform of endogenous alg-1 locus. sgRNA #1: TATTGCGGCCCGCCGGACAT; sgRNA #2: TCAAACGACCCAATGTCCGG. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816. |
| RG3544 |
pigc-1(ve1044[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. |
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Sterile. Deletion of 933 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile GFP+ non-mKate2 (ve1044 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: AAAATAATGACAGAAAACAGAATATTGTCG; Right flanking sequence: TGGTGTTGCCATTTGGCGAACGCATAACCT. pigc-1 crRNA A: AGGAAAGGCAAGGATACACG; pigc-1 crRNA B: AATATCTTCTGCCAACCCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3548 |
+/nT1 [umnIs49] IV; scpl-4(ve1048[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. |
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Larval arrest. Deletion of 2742 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve1048 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TATTTCTCATTATACAAAAATTTCAGATTT; Right flanking sequence: CGGTATATGACAGTTGAATTCTCCGTCTAC. scpl-4 crRNA A: TAAATCTCTTCTGGGCCCAC; scpl-4 crRNA B: ACACTAGAGTTGTTCAGAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| CQ757 |
wqIs7. |
wqIs7 [rgef-1p::his-58::GFP]. Pan-neuronal expression of nuclear-localized GFP. Can be used for single-nucleus RNA sequencing of neurons. Reference: St Ange J, et al. Cell Genom. 2024 Dec 11;4(12):100720. doi: 10.1016/j.xgen.2024.100720. PMID: 39637862. |
| ZM7247 |
daf-16(mu86) I; hpSi4 II; daf-2(e1370) III. |
hpSi4 [myo-3p::GFP::daf-16a + unc-119(+)]. Muscle-specific expression of GFP::DAF-16A. Weak GFP expression in muscle. This strain was used to generate muscle specific ChIP-seq data. Transgene inserted into ttTi5605 using MosSCI. Reference: Wu S, et al. 2026. G3 (In Press). |
| ZM8745 |
daf-16(mu86) I; hpSi15 II; daf-2(e1370) III. |
hpSi15 [ges-1p::GFP::daf-16a + unc-119(+)]. Gut-specific expression of GFP::DAF-16A. Weak GFP expression in gut. This strain was used to generate gut specific ChIP-seq data. Transgene inserted into ttTi5605 using MosSCI. Reference: Wu S, et al. 2026. G3 (In Press). |
| JAC127 |
csbIs6. |
csbIs6 [myo-3p::GFP::rpl-10a + lin-15(+)]. GFP expression in muscle. This strain was used to generate muscle specific RNAseq data. [NOTE: csbIs6 was previously described as carrying myo-3p::GFP::rpl-1. rpl-1 is another name for rpl-10a.] Reference: Wu S, et al. 2026. G3 (In Press). |
| ZM9156 |
daf-16(mu86) I; csbIs6. |
csbIs6 [myo-3p::GFP::rpl-10a + lin-15(+)]. Dauer-defective. GFP expression in muscle. This strain was used to generate muscle specific RNAseq data. [NOTE: csbIs6 was previously described as carrying myo-3p::GFP::rpl-1. rpl-1 is another name for rpl-10a.] Reference: Wu S, et al. 2026. G3 (In Press). |
| ZM10380 |
daf-2(e1370) III; csbIs6. |
csbIs6 [myo-3p::GFP::rpl-10a + lin-15(+)]. Maintain at 15C. Temperature sensitive dauer constitutive. GFP expression in muscle. This strain was used to generate muscle specific RNAseq data. [NOTE: csbIs6 was previously described as carrying myo-3p::GFP::rpl-1. rpl-1 is another name for rpl-10a.] Reference: Wu S, et al. 2026. G3 (In Press). |
| ACR194 |
reySi1 II. |
reySi1 [mex-5p::Nb::mKate2::nmy-2 3'UTR] II. Strain expressing an anti-ALFA tag nanobody coupled to the red fluorophore mKate2. Can be used for in vivo detection of ALFA-tagged proteins. Transgene inserted into ttTi5605 via CRISPR/Cas9. Red fluorescence in gonads and early embryos. Reference: Quintin S, et al. 2025. microPublication Biology. 10.17912/micropub.biology.001542. |
| MTG574 |
mms-19(mod412) V. |
mms-19(mod412) is a CRISPR/Cas9-engineered 6049 bp deletion. Sensitive to TMP/UVA-induced interstrand crosslinks (ICLs). Generated in N2 background. Left flanking sequence: acttaattcttcgataacgaagcacctttc; Right flanking sequence: tattaacgacaaactagatatacttttgtt. sgRNA#1 (N-terminal) : ATTAAGTTTCAAAGAAGGAA; sgRNA#2 (C-terminal): CTAGTTTGTCGTTAATAACC. ssODN: TCGCAACTTAATTCTTCGATAACGAAGCACCTTTCTATTAACGACAAACTAGATATACTTTTGTTTTGTCCTAAATTGT. Reference: Li et al., Nucleic Acid Res. 2024 Jul 16;52(16):9586–9595. doi: 10.1093/nar/gkae617. PMID: 41131702. |
| MTG479 |
ciao-2B(mod334) III. |
ciao-2B(mod334) is a CRISPR/Cas9-engineered missense variant [E137A]. Temperature-sensitive: maintain at 15-20C; reduced viability at 25C. Mild TMP/UVA-induced ICL sensitivity. Generated in N2 background. sgRNA: GGAACGAGTAGCTGCTGCAA. ssODN: GCCCCTCAAAAAGTTAATTTTTAAAACATAAATTCAAAATGTCTCATTTAGGACCGAGTAGCTGCTGCAATGGAAAATCAAGGACTAATGCACGCTGTTAACGAATGCCTCAGAGTTCCAGAA. Reference: Li et al., Nucleic Acid Res. 2024 Jul 16;52(16):9586–9595. doi: 10.1093/nar/gkae617. PMID: 41131702. |
| MTG635 |
dog-1(mod463) I. |
dog-1(mod463) is a CRISPR/Cas9-engineered missense variant [K121R]. TMP/UVA-sensitive (ICL repair defect) and shows G-tract instability (G4-DNA–induced deletions at qua830; 13/30 single-worm PCRs). Generated in N2 background. sgRNA: GACGGGAAGTGGCAAAACTA. ssODN: CGGCGCTGAAAAATAGTCAAAATGTGCTTGGCGAGTCGCCGACGGGAAGTGGCCGCACTATGGCTCTGCTGGCATCTACGTGTGCATGGCTCAAGCAGTATAT. Reference: Li et al., Nucleic Acid Res. 2024 Jul 16;52(16):9586–9595. doi: 10.1093/nar/gkae617. PMID: 41131702. |
| MTG634 |
dog-1(mod462 [3xFlag::dog-1(C278S)] *mod218) I. |
3xFLAG tag inserted into endogenous dog-1 locus carrying CRISPR/Cas9-engineered missense variant [C278S]. Variant associated with ICL-repair defect/TMP-UVA sensitivity. Generated by CRISPR/Cas9 modification of tagged dog-1 locus in parental strain MTG301. sgRNA: GATGTCTGCGTGTTTACGAG. ssODN: TTGTATTCAGACACACAATTCTCGCAAGCAGAGAACAATCTAGTATCAACCCTGCTGCTCGTAAACACGCAGACATCTCACAATACTGTAAAGAAGTGAAC. Reference: Li et al., Nucleic Acid Res. 2024 Jul 16;52(16):9586–9595. doi: 10.1093/nar/gkae617. PMID: 41131702. |
| MTG609 |
ciao-1(mod409) I; ciao-2B(mod334) III. |
ciao-1(mod409) is a CRISPR/Cas9-engineered missense variant (R71A). ciao-2B(mod334) is a CRISPR/Cas9-engineered missense variant [E137A]. ciao-1(mod409) suppresses the temperature-sensitive lethality of ciao-2B(mod334) (human CIAO2B(E140A) mimic). No G-tract deletions detected in qua830 G4-deletion assay (0/228 single-worm PCRs). sgRNA:
GGATGACAGTCATACACGGG. ssODN: CAAAACTCGCAGAAACTAGACATTTTCCGTCATTTGAAAATGCGACTGAGGCAACAGCCCGTGTATGACTGTCATCCAGTGTTGTACGACACTCCAGACGCA. mod334 is a missense variant (E137A) in ciao-2B. sgRNA: GGAACGAGTAGCTGCTGCAA. ssODN: GCCCCTCAAAAAGTTAATTTTTAAAACATAAATTCAAAATGTCTCATTTAGGACCGAGTAGCTGCTGCAATGGAAAATCAAGGACTAATGCACGCTGTTAACGAATGCCTCAGAGTTCCAGAA. Reference: Li et al., Nucleic Acid Res. 2024 Jul 16;52(16):9586–9595. doi: 10.1093/nar/gkae617. PMID: 41131702. |
| MTG675 |
gbh-1(mod479) II. |
gbh-1(mod479) is a CRISPR/Cas9-engineered missense allele [D72G]. Human-variant model. Generated in N2 background. sgRNA:GACAATGTTAGAGTTCGACG. ssODN:TCCTCATCAATCCATAATTTTCTAGCGTTTTGTTCGACTCCGAACTCTAACATTGTCAGCTTACGAGCAGTCATTGCGGG. Reference: Li et al., Nucleic Acid Res. 2024 Jul 16;52(16):9586–9595. doi: 10.1093/nar/gkae617. PMID: 41131702. |
| OL370 |
wrdSi23 I; unc-116(uk1[AID*::ALFA::unc-116]) III. |
wrdSi23 [eft-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). AID and ALFA epitope tags inserted at N-terminus of endogenous unc-116 locus. Slightly defective crawling and swimming ability compared to N2 when quantified. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Bostrom A, et al. J Cell Sci. 2026 Feb 23:jcs.264245. doi: 10.1242/jcs.264245. PMID: 41725581. |
| ZM11773 |
hpEx4664. |
hpEx4664 [C54F6.5::GFP + myo-2p::RFP]. Pick myo-2::RFP+ to maintain. C54F6.5 translational reporter containing the entire genomic region of C54F6.5 with the 1.2 kb of promoter sequence and 1.6 kb of 3' UTR region from its stop codon. GFP inserted in-frame after the last amino acid and immediately before the C54F6.5 3'UTR. GFP expression in muscles, more robust when starved. GFP accumulation in ceolomocytes. Reference: Wu S, et al. G3 (Bethesda). 2026 Mar 3:jkag030. doi: 10.1093/g3journal/jkag030. PMID: 41773048. |
| DLS1102 |
vit-6(rhd332) IV; vit-5(rhd322) vit-4(rhd321) vit-3(rhd320) vit-2(rhd352) vit-1(ok2616) X. |
Multiple mutations were simultaneously introduced into the vit-3, vit-4, and vit-5 loci using a single crRNA to produce vit-5(rhd322[T391E, L392F, A393*]), vit-4(rhd321[T391E, L392F, A393*]), and vit-3(rhd320[T391E, L392F, A393*]). A similar strategy was used to create vit-6(rhd332[S320F, W322*]). vit-2(rhd352) is a CRISPR-engineered deletion removing the entire vit-2 coding sequence generated in parental strain DLS1004 to produce DLS1102. Reference: Macharios MM, et al. MicroPubl Biol. 2025 Sep 10;2025:10.17912/micropub.biology.001789. doi: 10.17912/micropub.biology.001789. PMID: 41018027. |
| RG5113 |
eif-4A3(gk5416[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. |
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Apparent homozygous lethal or sterile deletion balanced over labeled hT1. Pick wild-type GFP+ & mKate2+ to maintain. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, GFP+ non-mKate2 gk5416 homozygotes (lethal/sterile), arrested hT1 homozygotes (mKate2+), and dead eggs. gk5416 is a deletion of 638 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CAACCAGTCCACCTTTCTACGTGTATTACA. Right flanking sequence: CGGGGATGGCGCGTTGCTGGATGGCAGATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG5114 |
vps-4(gk5783[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. |
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Apparent homozygous lethal or sterile deletion balanced over labeled hT1. Pick wild-type GFP+ & mKate2+ to maintain. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, GFP+ non-mKate2 gk5783 homozygotes (slow growing, lethal/sterile), arrested hT1 homozygotes (mKate2+), and dead eggs. gk5783 is a deletion of 6128 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCGCCAGCTTATCCCCTGGAACATCCAACC. Right flanking sequence: AACGGCTCACACAACAACTCACACACACAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG5115 |
Y65B4A.8(gk5849[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. |
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Apparent homozygous lethal or sterile deletion balanced over labeled hT1. Pick wild-type GFP+ & mKate2+ to maintain. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, GFP+ non-mKate2 gk5849 homozygotes (lethal/sterile), arrested hT1 homozygotes (mKate2+), and dead eggs. Derived from parental strains VC4781 and CGC75. gk5849 is a deletion of 3386 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GACGGTCCACGTTTCGGCGAGCGTTTTGTG. Right flanking sequence: CGGCTGCGCGTCTCTATTTCACACACTGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| ZM11774 |
hpEx4665. |
hpEx4665 [C54F6.5::SL2::NLS::RFP::C54F6.5 3'UTR + odr-1p::GFP]. Pick GFP+ to maintain. C54F6.5 translational reporter containing 1.2 kb of promoter sequence and 1.6 kb of 3' UTR region downstream of the stop codon. Weak nuclear RFP expression in muscles of adults. Dauers exhibit strong nuclear RFP expression in muscles. Reference: Wu S, et al. G3 (Bethesda). 2026 Mar 3:jkag030. doi: 10.1093/g3journal/jkag030. PMID: 41773048. |
| ZM11338 |
hpEx4489. |
hpEx4489 [cex-1p::RFP::cex-1 3' UTR+ ttx-3p::GFP]. Pick GFP+ animals to maintain. RFP transcriptional reporter for cex-1 with endogenous cex-1 3’ UTR. RFP expression in RIM; little RFP expression levels in muscle cells. Reference: Wu S, et al. G3 (Bethesda). 2026 Mar 3:jkag030. doi: 10.1093/g3journal/jkag030. PMID: 41773048. |
| ZM11725 |
hpEx4650. |
hpEx4650 [mlcd-1p::GFP::mlcd-1 3' UTR + myo-2p::RFP]. Pick RFP+ animals to maintain. GFP transcriptional reporter for mlcd-1 with endogenous mlcd-1 3’ UTR. Reference: Wu S, et al. G3 (Bethesda). 2026 Mar 3:jkag030. doi: 10.1093/g3journal/jkag030. PMID: 41773048. |
| ZM7971 |
lin-15B&lin-15A(n765) hpIs331 X; hpIs321. |
hpIs331 [lgc-55Bp::tomm20::miniSOG::SL2::wCherry + lin-15(+)] X. hpIs321 [nmr-1p::tomm20::miniSOG::SL2::wCherry + lin-15(+)]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2) induces mitochondrial-miniSOG ablation of AVA, AVB, AVE, AVD, and RIM premotor interneurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat dissipator to keep the air cool. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915. PMID: 29360035. |
| ZM9133 |
lin-15B&lin-15A(n765) X; hpIs583; hpIs589. |
hpIs583 [acr-2(s)p::tomm20::miniSOG::SL2::wCherry + lin-15(+)]. hpIs589 [myo-3p::GCaMP6::wCherry + ttr-39p::miniSOG::SL2::eBFP + lin-15(+)]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2) induces mitochondrial-miniSOG ablation of A-, B-, and D-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat dissipator to keep the air cool. acr-2s(p) is a 1.8 kb fragment of the acr-2 promoter driving expression in only A- and B- class motor neurons (described in Jospin et al, 2009 PLoS Biol. Dec;7(12):e1000265). GCaMP6 and wCherry in muscles. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915. |
| ZM8415 |
juIs440 II; lin-15B&lin-15A(n765) X; hpIs321. |
juIs440 [sra-11p::mito-miniSOG + sra-11p::mCherry] II. hpIs321 [nmr-1p::tomm20::miniSOG::SL2::wCherry + lin-15(+)]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2) induces mitochondrial-miniSOG ablation of AVA, AVB, AVE, AVD, and RIM premotor interneurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat dissipator to keep the air cool. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915. PMID: 29360035. |
| ZM7862 |
lin-15B&lin-15A(n765) hpIs331 X; hpIs321; hpIs372. |
hpIs331 [lgc-55Bp::tomm20::miniSOG::SL2::wCherry + lin-15(+)] X. hpIs321 [nmr-1p::tomm20::miniSOG::SL2::wCherry + lin-15(+)]. hpIs372 [acr-5p::tomm-20::miniSOG::SL2::wCherry + lin-15(+)]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2) induces mitochondrial-miniSOG ablation of AVA, AVB, AVE, AVD, RIM premotor interneurons, and B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat dissipator to keep the air cool. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915. PMID: 29360035. |
| ZM7870 |
hpIs371 IV; lin-15B&lin-15A(n765) hpIs331 X; hpIs321; |
hpIs371 [unc-4p::tomm-20::miniSOG::SL2::wCherry + lin-15(+)] IV. hpIs331 [lgc-55Bp::tomm20::miniSOG::SL2::wCherry + lin-15(+)] X. hpIs321 [nmr-1p::tomm20::miniSOG::SL2::wCherry + lin-15(+)]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2) induces mitochondrial-miniSOG ablation of AVA, AVB, AVE, AVD, RIM premotor interneurons, and A-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat dissipator to keep the air cool. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915. PMID: 29360035. |
| ZM7921 |
lin-15B&lin-15A(n765) hpIs331 X; hpIs321; hpIs376. |
hpIs331 [lgc-55Bp::tomm20::miniSOG::SL2::wCherry + lin-15(+)] X. hpIs321 [nmr-1p::tomm20::miniSOG::SL2::wCherry + lin-15(+)]. hpIs376 [unc-25p::tomm20::miniSOG::SL2::wCherry + lin-15(+)]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2) induces mitochondrial-miniSOG ablation of AVA, AVB, AVE, AVD, RIM premotor interneurons, and D-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat dissipator to keep the air cool. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915. PMID: 29360035. |
| OH20145 |
zfh-2(ot1709)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I. |
Homozygous lethal mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are non-Dpy with relatively dim pharyngeal GFP (Venus) expression, and segregate heterozygous non-Dpy Venus+, non-Venus ot1709 homozygotes (L1 arrest), and Dpy with brighter Venus+ (tmC20 homozygotes). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. zfh-2(ot1709) is a CRISPR/Cas9-engineered >30kb deletion of the entire zfh-2 locus. crRNA1: CTACCATTTAGCCAATATAT. crRNA2: GTAGTAGTAGTAGTATGAGG. ssODN: aaattcatccaaaaaaatttccagagttgccccgcccataCATACTACTACTACTACCACGACGACGCCATAAcaaaacc. Reference: Sussfeld A, et al. bioRxiv 2026.01.13.699069; doi: https://doi.org/10.64898/2026.01.13.699069. |
| PHX10278 |
zfh-2(syb10278[zfh-2::GSGGSGGTGGSG::mIAA7::wrmScarlet-I3::mIAA7]) I. |
Endogenous zfh-2 locus tagged at C terminus with linker::mIAA7::mScarletI3::mIAA7. Linker sequence GSGGSGGTGGSG. Reference: Sussfeld A, et al. bioRxiv 2026.01.13.699069; doi: https://doi.org/10.64898/2026.01.13.699069. |
| OH20419 |
zfh-2(syb10278[zfh-2::GSGGSGGTGGSG::mIAA7::wrmScarlet-I3-mIAA7]) I; otSi4 II. |
otSi4 [myo-2p::TIR1(F79G)::mRuby::unc-54 3'UTR *ieSi60] II. Endogenous zfh-2 locus tagged at C terminus with linker::mIAA7::mScarletI3::mIAA7. Linker sequence GSGGSGGTGGSG. Reference: Sussfeld A, et al. bioRxiv 2026.01.13.699069; doi: https://doi.org/10.64898/2026.01.13.699069. |
| OH20425 |
zfh-2(ot1787 *syb10278)/tmC20[unc-14(tmIs1219) dpy-5(tm9715)] I. |
Homozygous sterile mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are non-Dpy with relatively dim pharyngeal GFP (Venus) expression, and segregate heterozygous non-Dpy Venus+, non-Venus ot1709 homozygotes (L1 arrest), and Dpy with brighter Venus+ (tmC20 homozygotes). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Second homeodomain deleted from endogenous zfh-2 locus tagged at C terminus with linker::mIAA7::mScarletI3::mIAA7. Linker sequence GSGGSGGTGGSG. ot1787 crRNA1: TCCTGCAACACGTCGTCCAG. crRNA2: CGGCGTTCTCACAAATCGAT. ssODN: ATGACACCGAGCACTCCTTCCTGCAACACGTCGTCCtcTGGACGAATCTATGAGAATCAGCCGAATCACGAGAGTTCtGATCGATTTGTGAGAACGCCGGGATCGAACTTTCAGTGC. Reference: Sussfeld A, et al. bioRxiv 2026.01.13.699069; doi: https://doi.org/10.64898/2026.01.13.699069. |