Species Information: C. elegans

Name C. elegans

C. elegans strains available at the CGC

Strain Genotype Description
RG3537 semi-1(ve1037[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 2957 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acaaAATGATGGGCACGAGTACCATGAAGA ; Right flanking sequence: AGGTCGTTCTTCTGGTTTCATAAATTTTGA. semi-1 crRNA A: GGAACAGATTAATTTAgggg; semi-1 crRNA B: TGATGTTCTACAGCCATTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3538 ZK1240.8(ve1038[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 1716 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTGTAATCCTCTTTTCCCTTTCATCAACCA ; Right flanking sequence: ATTAGATAACAAAATAGATTAGTAAGAGTA. ZK1240.8 crRNA A: TTTCAGTAGAATCCGTCAAT; ZK1240.8 crRNA B: GCTCCTTTAGTGACATGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
ZM5838 hpIs223. hpIs223 [rgef-1p::GFP::FUS + lin-15(+)]. GFP expression in neurons. Essentially wild-type movement; slight difference compared to N2 animals. C. elegans model for FUS ALS gene mutation. Reference: Murakami T, et al. Neuron. 2015 Nov 18;88(4):678-90. doi: 10.1016/j.neuron.2015.10.030. PMID: 26526393.
MD5004 drp-1(dx230[drp-1::mNeonGreen]) IV. mNeonGreen tag inserted into the variable region of endogenous drp-1 locus (internal tag). N- and C-terminal fusions of DRP-1 cause a block in mitochondrial fission (acting as dominant-negatives), whereas internally-tagged DRP-1 protein has close to wild-type activity. Generated in N2 background. Reference: Lambie EJ & Conradt B. MicroPubl Biol. 2025 May 8;2025:10.17912/micropub.biology.001588. PMID: 40415901.
MD5016 egl-1(dx243[mSG::egl-1]) V. Coding sequence for monomeric StayGold (mSG) inserted at the beginning of the 2nd exon of the endogenous egl-1 locus. mSG::EGL-1 retains close to wild-type activity (0.3 extra cells in the anterior pharynx compared to 11.9 extra cells for egl-1(n1084 n3082)).
RG3542 bgnt-1.7(ve1042[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Homozygous viable. Deletion of 1979 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACTGGAAATTTTCAAATCGTAAAAGGTCCA ; Right flanking sequence: CGGGTTTTCCTCTTGTTCTCCATAAACACC. bgnt-1.7 crRNA A: CCAGACACTACAACAAGATG; bgnt-1.7 crRNA B: TTTTGAGAAGCTGCGCCGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.