Species Information: C. elegans

Name C. elegans

C. elegans strains available at the CGC

Strain Genotype Description
PS10501 pam-1(sy2224) IV. Superficially wild-type but reduced brood size/early eggs laid/fewer viable eggs. CRISPR/Cas9 engineered STOP-IN null mutant of pam-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTTTCAGAATGGCGGCCTGTGGAAACCCAAGCG. right flanking sequence: CGGCGGTCAAATTTGAGAGGCTTCCAACATTCGCC. inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGTGGAAACCCAAGCGCGG. Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS10497 gst-25(sy2221) I. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of gst-25. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTGACTTATCAAAATGACCCTTAAATTCTCCTACT. right flanking sequence: TTGGAACCCGCGGTATCGGTGAGCCGATTCGTATG. inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GATACCGCGGGTTCCAAAGT. Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
SSR1578 ssrIs1248. ssrIs1248 [ges-1p(deltaB)::rpl-22::3xHA + ges-1p(deltaB)::GFP + pSM(empty vector)]. ges-1p(deltaB) is an INT1-specific promoter. Strain can be used for INT1-specific RiboTRAP experiments. Generated in N2 background. Reference: Liu C, et al. bioRxiv 2025.10.03.680215; doi: https://doi.org/10.1101/2025.10.03.680215
SSR1605 ssrIs1251. ssrIs1251 [pho-1p::rpl-22::3xHA + pho-1p::mCherry + pSM(empty vector)]. pho-1p is an INT2-9-specific promoter. Strain can be used for INT2-9-specific RiboTRAP experiments. Generated in N2 background. Reference: Liu C, et al. bioRxiv 2025.10.03.680215; doi: https://doi.org/10.1101/2025.10.03.680215
ZM5842 hpIs228. hpIs228 [rgef-1p::GFP::FUS[R522G] + lin-15(+)]. GFP expression in neurons. Slow motor activity compared to animals expressing wild-type GFP::FUS under the same promoter. C. elegans model for FUS ALS gene mutation. Reference: Murakami T, et al. Neuron. 2015 Nov 18;88(4):678-90. doi: 10.1016/j.neuron.2015.10.030. PMID: 26526393.
ZM5844 hpIs233. hpIs233 [rgef-1p::GFP::FUS[P525L] + lin-15(+)]. GFP expression in neurons. Slow motor activity compared to animals expressing wild-type GFP::FUS under the same promoter. C. elegans model for FUS ALS gene mutation. Reference: Murakami T, et al. Neuron. 2015 Nov 18;88(4):678-90. doi: 10.1016/j.neuron.2015.10.030. PMID: 26526393.
AMJ912 jamSi28 II; rde-4(ne301) III. jamSi28 [myo-3p::rde-4(+)::rde-4 3' UTR + unc-119(+)] II. Enables RNAi silencing in body wall muscles in an otherwise rde-4(ne301) background. jamSi28 was integrated into ttTi5605 II in an EG4322 background using MosSCI. Unknown if unc-119(ed9) is still present or homozygous in background. An isolated inserted line was crossed into AMJ8 (juIs73 [unc-25p::GFP] III) to temporarily balance the endogenous rde-4 locus during the subsequent cross; resulting jamSi28 heterozygous males were crossed into WM49 (rde-4(ne301) III). rde-4(ne301) presumed to be homozygous in this strain due to crossing strategy and minimal recombination between rde-3 and juIs73. Reference: Raman P, et al. Nucleic Acids Res. 2017 Aug 21;45(14):8463-8473. doi: 10.1093/nar/gkx484. PMID: 28541563.
AMJ565 jamSi6 II; rde-4(ne301) III. jamSi6 [nas-9p::rde-4(+)::rde-4 3' UTR + unc-119(+)] II. Enables RNAi silencing in body wall muscles in an otherwise rde-4(ne301) background. jamSi6 was integrated into ttTi5605 II in an EG4322 background using MosSCI. Unknown if unc-119(ed9) is still present or homozygous in background. An isolated inserted line was crossed into AMJ8 (juIs73 [unc-25p::GFP] III) to temporarily balance the endogenous rde-4 locus during the subsequent cross; resulting jamSi6 heterozygous males were crossed into WM49 (rde-4(ne301) III). rde-4(ne301) presumed to be homozygous in this strain due to crossing strategy and minimal recombination between rde-3 and juIs73. Reference: Raman P, et al. Nucleic Acids Res. 2017 Aug 21;45(14):8463-8473. doi: 10.1093/nar/gkx484. PMID: 28541563.
RG3537 semi-1(ve1037[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 2957 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acaaAATGATGGGCACGAGTACCATGAAGA ; Right flanking sequence: AGGTCGTTCTTCTGGTTTCATAAATTTTGA. semi-1 crRNA A: GGAACAGATTAATTTAgggg; semi-1 crRNA B: TGATGTTCTACAGCCATTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3538 ZK1240.8(ve1038[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 1716 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTGTAATCCTCTTTTCCCTTTCATCAACCA ; Right flanking sequence: ATTAGATAACAAAATAGATTAGTAAGAGTA. ZK1240.8 crRNA A: TTTCAGTAGAATCCGTCAAT; ZK1240.8 crRNA B: GCTCCTTTAGTGACATGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
ZM5838 hpIs223. hpIs223 [rgef-1p::GFP::FUS + lin-15(+)]. GFP expression in neurons. Essentially wild-type movement; slight difference compared to N2 animals. C. elegans model for FUS ALS gene mutation. Reference: Murakami T, et al. Neuron. 2015 Nov 18;88(4):678-90. doi: 10.1016/j.neuron.2015.10.030. PMID: 26526393.
MD5004 drp-1(dx230[drp-1::mNeonGreen]) IV. mNeonGreen tag inserted into the variable region of endogenous drp-1 locus (internal tag). N- and C-terminal fusions of DRP-1 cause a block in mitochondrial fission (acting as dominant-negatives), whereas internally-tagged DRP-1 protein has close to wild-type activity. Generated in N2 background. Reference: Lambie EJ & Conradt B. MicroPubl Biol. 2025 May 8;2025:10.17912/micropub.biology.001588. PMID: 40415901.
MD5016 egl-1(dx243[mSG::egl-1]) V. Coding sequence for monomeric StayGold (mSG) inserted at the beginning of the 2nd exon of the endogenous egl-1 locus. mSG::EGL-1 retains close to wild-type activity (0.3 extra cells in the anterior pharynx compared to 11.9 extra cells for egl-1(n1084 n3082)).
GS9324 arTi351 V. arTi351 [lin-31p::GFP::Tcut::mScarlet::H2B::unc-54 3’UTR] V:-12.74. Reporter-only control for SALSA biosensor; pair with GS9338. Reference: Shaffer JM & Greenwald I. Dev Cell. 2022 Apr 11;57(7):930-944.e6. doi: 10.1016/j.devcel.2022.03.008. PMID: 35413239.
GS9338 lin-12(ar640[lin-12::TEVp]) III; arTi351 V. arTi351 [lin-31p::GFP::Tcut::mScarlet::H2B::unc-54 3’UTR] V:-12.74. Strain for SALSA analysis in VPCs; pair with control strain GS9324. Reference: Shaffer JM & Greenwald I. Dev Cell. 2022 Apr 11;57(7):930-944.e6. doi: 10.1016/j.devcel.2022.03.008. PMID: 35413239.
RG3539 R74.7(ve1039[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Homozygous viable. Deletion of 1268 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCATTCTCTGGACGAATTCATGCAAGCCG ; Right flanking sequence: TCTCTAAACCTCTTCTGTTTTCTCTTCACA. R74.7 crRNA A: GAAGGCAGCGAGGATTAGTT; R74.7 crRNA B: AAAATGCGAGGGACAGAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3542 bgnt-1.7(ve1042[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Homozygous viable. Deletion of 1979 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACTGGAAATTTTCAAATCGTAAAAGGTCCA ; Right flanking sequence: CGGGTTTTCCTCTTGTTCTCCATAAACACC. bgnt-1.7 crRNA A: CCAGACACTACAACAAGATG; bgnt-1.7 crRNA B: TTTTGAGAAGCTGCGCCGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
ERT529 unc-119(ed3) III; jySi40. jySi40 [vha-6p::NANOLUC::3xFLAG::unc-54 3' UTR + Cbr-unc-119(+)]. Can be used as a Nanoluciferase (NanoLuc) expressing control for luminescence in Promega NanoGlow Assays. Reference: Sfarcic I, et al. Genetics. 2019 Dec;213(4):1197-1207. doi: 10.1534/genetics.119.302655. PMID: 31585955.
GS10011 arTi479 [unc-47p::cre::unc-54 3'UTR] I. miniMOS insertion expressing cre recombinase specifically in GABAergic neurons. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038.
OH18562 unc-119(ed3) III; otIs898[*oxTi553] V. otIs898 [pha-4prom2::3xNLS::ceGCaMP6s::unc-54 3' UTR]. Neuron-specific cis regulatory fragment of pha-4 driving expression of C. elegans codon-optimized GCaMP6s in enteric neurons. The multicopy array was inserted at the oxTi553 landing site (EG7944) by FLInt. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038.
OH19864 fog-29(q71) pha-4(ot1506)/stu-3(q265) rol-9(sc148) V. Heterozygous. Pick wild-type to maintain. ot1506 is a full (6665bp) deletion of the pha-4 locus coding region from the start codon of the longest isoform to the stop codon. Heterozygotes appear wild-type, and segregate wild-type heterozygotes, fog-29(q71) pha-4(ot1506) homozygotes (arrest as embryos or L1s), Sterile Rollers. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038.
OH19945 pha-4(syb5755[pha-4::3xGAS::GFP::3xGAS::AID*::TEV::LoxP::3xFLAG] *ot1078 *ot946) otIs908 V. otIs908 [pha-4(prom2)::TIR1(F79G)::mTur2::tbb-2 3'UTR + unc-122p::mCherry::unc-54 3' UTR] V. Endogenously-tagged pha-4::GFP::AID crossed with enteric neuron-specific TIR1(F79G), allowing depletion of PHA-4 from pharyngeal nerons, AVL, and RIS by addition of 5-Ph-IAA. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038.
OH18512 pha-1(e2123) III; otEx8085. otEx8085 [pha-4(prom2)::GFP::unc-54 3'UTR + pha-1(+)]. Maintain at 25C to select for animals carrying the array. pha-4 cis-regulatory element drives expression specifically in all 20 pharyngeal enteric neurons, 2 hindgut enteric neurons, as well as RIS and PVT. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038.
OH20089 otEx8333. otEx8333 [sre-22p::GFP::H2B::tbb-2 3'UTR + unc-122p::GFP]. Maintain by picking GFP+ in coelomocytes. sre-22 promoter fragment drives expression specifically in PVT neuron. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038.
OH20099 pha-4(ot1078[loxp::pha-4::GFP::loxP] *ot946) V; otEx8343. otEx8343 [sre-22p::2xFlag::NLS::Cre::unc-54 3'UTR + unc-122p::GFP]. Maintain by picking GFP+ in coelomocytes. sre-22 promoter fragment drives expression specifically in PVT neuron, allowing PVT cell-specific Cre-Lox elimination of pha-4 in animals carrying the array. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038.
OH20095 egl-3(nu1711[loxP::egl-3::loxP]) V; otEx8339. otEx8339 [sre-22p::2xFlag::NLS::Cre::unc-54 3'UTR + unc-122p::GFP]. Maintain by picking GFP+ in coelomocytes. sre-22 promoter fragment drives expression specifically in PVT neuron, allowing PVT cell-specific Cre-Lox elimination of egl-3 in animals carrying the array. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038.
RG3541 +/mT1 [umnIs52] II; spe-21(ve1041[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Semi sterile. Deletion of 1602 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 ve1041 homozygotes (mostly sterile; see below), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Most ve1051 homozygotes lay only oocytes, but a few escaper ve1041 GFP+ hemaphrodites can lay small broods of similarly semi-sterile progeny. Left flanking Sequence: GCGAGATTTGGTAACTGAAAAAGGTAACCA; Right flanking sequence: ATTCGGCAAAATCAGATAATAAGAAATTCG. dhhc-5 crRNA A: TGGGTGCATGGACTATTGCA; dhhc-5 crRNA B: GTGGTTGGAACGCACAAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
WEH690 sam-4(syb4007[sam-4::mScarlet-I]) ctns-1(syb5851[ctns-1::mCitrine]) II. mScarlet-I tag inserted into the C-terminus of endogenous sam-4 locus. mCitrine tag inserted into the C-terminus of endogenous ctns-1 locus. Punctate expression in early embryos. Green fluorescence can be seen throughout development, but is dimmer than the mScarlet version. Reference: Fazeli G, et al. Curr Biol. 2023 Feb 27;33(4):607-621.e7. doi: 10.1016/j.cub.2022.12.041. PMID: 36652947.
WEH559 wurIs90 II; unc-119(ed3) III; arl-8(syb2427[arl-8::mCitrine]) IV. wurIs90 [pie-1p::mCherry::PH::ZF1 + unc-119(+)] II. mCitrine tag inserted into the C-terminus of endogenous arl-8 locus. Punctate green fluorescence in early embryos. Red Fluorescence at the membrane of gonads and embryos until the 4-cell stage, when the membrane marker is degraded in somatic cells due to the ZF1 degron. Reference: Fazeli G, et al. Curr Biol. 2023 Feb 27;33(4):607-621.e7. doi: 10.1016/j.cub.2022.12.041. PMID: 36652947.
RG3545 F47B8.10(ve1045[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 2846 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGTCTTATCTGTTTCCTTCTTCTCATCCCA ; Right flanking sequence: ATTGTTTTATGAAATTAAAGCAAATAAAAT. F47B8.10 crRNA A: ACAAAATCGTACATTGTGGG; F47B8.10 crRNA B: TCAAAAAATGCAGTTCGTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3543 tsct-2(ve1043[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Sterile. Deletion of 9001 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, sterile GFP+ non-mKate2 (ve1043 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GAGAATAAGGAGAAGAAGCAACAAGTACCG; Right flanking sequence: CGGGTAGCTAACTAAAATGTGAAGAGCTAT. Y48C3A.12 sgRNA A: GGTGTATTCATCGGTGTCGG; Y48C3A.12 sgRNA B: TCCCCCGTCCAAACCACGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3540 +/mT1 [umnIs52] II; rps-14(ve1040[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval arrest. Deletion of 921 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve1040 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: agctgagccttcgatctgaacaaactccca; Right flanking sequence: tggaaaaagtcgctacgcagccaatggtct. rps-14 crRNA A: atagttaagtatgctctggc; rps-14 crRNA B: ttggctgcgtatcatttcca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3536 nuaf-3(ve1036[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Sterile. Deletion of 1840 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile GFP+ non-mKate2 (ve1036 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GATTTCTGAGCAGTTCATCAAAAAATACGA; Right flanking sequence: CGGAAAAGCTGCAGAATTGTCATAGCCTGA. nuaf-3 crRNA A: TAGGAGGAGGAGATGCGAAT; nuaf-3 crRNA B: GATGCCAGTGTACAGAGAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3546 Y43E12A.2(ve1046[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Homozygous viable. Deletion of 2583 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CACACCTTATTATTAAAATAGTATTGCCCT ; Right flanking sequence: GATATCACGTCGTCATTGATTTTATTGACA. Y43E12A.2 crRNA A: GGAGAAAAGCAAGGGAAAAA; Y43E12A.2 crRNA B: TCTTCGTGTTTCCGTGCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3547 W01B6.3(ve1047[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Homozygous viable. Deletion of 2025bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCGTGTTTGAAACAACTGTTTTGTTTACCT ; Right flanking sequence: AGGGCAGTTTTGCATAGTTTCCGTCTCATT. W01B6.3 crRNA A: AATCATTGGCCCGAGAAAAC; W01B6.3 crRNA B: GTGGATTAGGCAAATGAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
TAM93 pash-1(ram33[G179R]) I. Maintain at 15C. Low penetrance protruding vulva and bursting at permissive temperatures. pash-1(ram33[G179R]) is a G754A substitution (relative to the start codon in T22A3.5A.1) that results in a G179R substitution in the PASH-1 WW domain. Reference: Knittel TL, et al. Nat Commun. 2025 Jul 1;16(1):5595. doi: 10.1038/s41467-025-60721-5. PMID: 40595566.
TAM94 pash-1(syb4327[W180A]) I. Maintain at 15C. Reduced brood size. Low penetrance protruding vulva and bursting. Temperature sensitive-sterility. pash-1(syb4327[W180A]) is a TGG to GCA substitution at position 756 (relative to the start codon in T22A3.5A.1) that results in a W180A substitution in the PASH-1 WW domain. Reference: Knittel TL, et al. Nat Commun. 2025 Jul 1;16(1):5595. doi: 10.1038/s41467-025-60721-5. PMID: 40595566.
TAM95 drsh-1(syb6628[mCherry::drsh-1]) pash-1(syb6091[pash-1::GFP]) I. mCherry tag inserted inserted directly after start codon of endogenous drsh-1 locus. GFP tag inserted directly before the stop codon of endogenous pash-1 locus. Fluorescence enriched in nuclei of embryos and germ cells. Reference: Knittel TL, et al. Nat Commun. 2025 Jul 1;16(1):5595. doi: 10.1038/s41467-025-60721-5. PMID: 40595566.
TAM109 ramTi3 II. ramTi3 [ubl-1::mCherry::pri-mir-58 + Cbr-unc-119(+)] II. mCherry-based sensor for pri-miR-58 processing. Weak ubiquitous mCherry fluorescence. MosSCI insertion. Previously described as ram3. Reference: Knittel TL, et al. Nat Commun. 2025 Jul 1;16(1):5595. doi: 10.1038/s41467-025-60721-5. PMID: 40595566.
GS9317 arSi85 I. arSi85 [mex-5p::GFP::Tcut::mCherry::H2B::tbb-2 3’UTR] I: -5.31. Reporter-only control for SALSA biosensor; pair with GS9447. Reference: Shaffer JM & Greenwald I. Dev Cell. 2022 Apr 11;57(7):930-944.e6. doi: 10.1016/j.devcel.2022.03.008. PMID: 35413239.
GS9447 arSi85 I; glp-1(ar648[glp-1::TEVp]) III. arSi85 [mex-5p::GFP::Tcut::mCherry::H2B::tbb-2 3’UTR] I: -5.31. Strain for SALSA analysis; pair with control strain GS9317. Reference: Shaffer JM & Greenwald I. Dev Cell. 2022 Apr 11;57(7):930-944.e6. doi: 10.1016/j.devcel.2022.03.008. PMID: 35413239.
GS9322 arTi355 IV; arTi237 X. arTi355 [rps-27p::GFP(flexon)::Tcut::mScarlet::H2B] IV. arTi237 [ckb-3p::Cre(opti)] X:11.72. Reporter-only control for SALSA biosensor; pair with GS9314. Reference: Shaffer JM & Greenwald I. Dev Cell. 2022 Apr 11;57(7):930-944.e6. doi: 10.1016/j.devcel.2022.03.008. PMID: 35413239.
GS9314 lin-12(ar640[lin-12::TEVp]) III; arTi355 IV; arTi237 X. arTi355 [rps-27p::GFP(flexon)::Tcut::mScarlet::H2B] IV. arTi237 [ckb-3p::Cre(opti)] X:11.72. Strain for SALSA analysis; pair with control strain GS9322. Reference: Shaffer JM & Greenwald I. Dev Cell. 2022 Apr 11;57(7):930-944.e6. doi: 10.1016/j.devcel.2022.03.008. PMID: 35413239.
WRM113 mex-3(spr37) I. Homozygous fertile, reduced brood at 25C. mex-3(spr37) is a CRISPR/Cas9 engineered indel removing nucleotides 28-651 of the mex-3 3’ UTR and inserting the sequence 5’-TTCATTCCAATT-3’ between break points. Displays temperature-sensitive embryonic lethality phenotype at 25C seen in other mex-3 3’ UTR deletion strains, though less penetrate than observed in GFP-tagged mutants. Derived in N2 background. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769.
WRM75 mex-3(spr9[*tn1753]) I; ltSi539 II; ltSi507 IV; nre-1(hd20) lin-15B(hd126) X; stIs10389. Homozygous fertile, nearly fully penetrant embryonic lethal phenotype at 25C. mex-3(spr9) is a CRISPR/Cas9 engineered deletion of the mex-3 3´UTR (removes 624 of 689 bp) derived by modification of parental strain DG4269 mex-3(tn1753[gfp::3xflag::mex-3]) I. ltSi539 [dlg-1p(delta)7::mCherry::his-72::unc-54 3’UTR + cnd-1p::mCherry::his-72::unc-54 3’UTR + Cbr-unc-119(+)] II. ltSi507 [hlh-1p::GFP::his-72::tbb-2 3’UTR + hlh-1p::mCherry::his-72::tbb-2 3’UTR +Cbr-unc-119(+)] IV. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. During embryogenesis, ectoderm fluoresces red, mesoderm fluoresces yellow, and endoderm/pharynx fluoresces green. Derived by crossing parental strains WRM52 and OD1854. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769.
WRM77 mex-3(tn1753[gfp::3xflag::mex-3]) I; ltSi539 II; ltSi507 IV; nre-1(hd20) lin-15B(hd126) X; stIs10389. Homozygous fertile. ltSi539 [dlg-1p(delta)7::mCherry::his-72::unc-54 3’UTR + cnd-1p::mCherry::his-72::unc-54 3’UTR + Cbr-unc-119(+)] II. ltSi507 [hlh-1p::GFP::his-72::tbb-2 3’UTR + hlh-1p::mCherry::his-72::tbb-2 3’UTR +Cbr-unc-119(+)] IV. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. During embryogenesis, ectoderm fluoresces red, mesoderm fluoresces yellow, and endoderm/pharynx fluoresces green. Derived by crossing parental strains DG4269 and OD1854. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769.
WRM79 mex-3(spr9[*tn1753]) I; sprSi1 II; unc-119(ed3) III. Homozygous fertile, nearly fully penetrant embryonic lethal phenotype at 25C. sprSi1 [pie-1p::GFP::histone-H2B::nos-2(MRE mut) 3'UTR + Cbr-unc-119(+)] II. mex-3(spr9) is a CRISPR/Cas9 engineered deletion of the mex-3 3´UTR (removes 624 of 689 bp) derived by modification of parental strain DG4269 mex-3(tn1753[gfp::3xflag::mex-3]) I. Nuclear GFP fluorescence in germline progenitor cells in early embryos. Derived by crossing parental strains WRM52 and WRM1. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769.
WRM80 mex-3(tn1753[gfp::3xflag::mex-3]) I; sprSi1 II; unc-119(ed3) III. sprSi1 [pie-1p::GFP::histone-H2B::nos-2(MRE mut) 3'UTR + Cbr-unc-119(+)] II. Homozygous fertile. Nuclear GFP fluorescence in germline progenitor cells in early embryos. Derived by crossing parental strains DG4269 and WRM1. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769.
WRM81 mex-3(spr9[*tn1753]) I; pgl-1(spr20[mCherry::pgl-1]) IV. Homozygous fertile, reduced brood at 25C. mCherry tag inserted at N-terminus of endogenous pgl-1locus in parental strain WRM52. mex-3(spr9) is a CRISPR/Cas9 engineered deletion of the mex-3 3´UTR (removes 624 of 689 bp) derived by modification of parental strain DG4269 mex-3(tn1753[gfp::3xflag::mex-3]) I. Homozygous fertile; reduced brood size. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769.
WRM82 mex-3(tn1753[gfp::3xflag::mex-3]) I; pgl-1(spr20[mCherry::pgl-1] IV. mCherry tag inserted at N-terminus of endogenous pgl-1locus in parental strain DG4269. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769.