Caenorhabditis Genetics Center (CGC)

Laboratory Information

NameQC View on WormBase
Allele designationet
HeadPilon, Marc
InstitutionUniversity of Gothenburg
Address Marc Pilon
Dept Chem Mol Biol, Univ. Gothenburg
BOX 462, Medicinaregatan 9E
GOTHENBURG 405 30
Sweden
Website http://www.molbio.gu.se/staff/molmpi/Marc_Pages/Pilon_Home.html
Gene classes fsr  mnm  paqr  fld 

Strains contributed by this laboratory

Strain Genotype Species Description
NL2003 ric-19(pk690) I. C. elegans pk690 is a deletion allele within the gene C32E8.7. The deletion is stable in the homozygous state and has no obvious phenotype. Can verify the presence/homozygosity of the deletion by PCR using the following primers: AL1: 5'-CGACGACACTCCATTATTCC-3' AR1: 5'-CCAGTCCTGCAAAAATGCTC-3'. A product of about 3.7 kb is obtained from WT worms, while a product of about 1 kb is obtained from NL2003 worms. The deletion has been sequenced and covers position -354 to +2276.
PHX3258 nhr-49(syb3258[nhr-49::GFP]) I. C. elegans GFP tag inserted at C-terminus of endogenous nhr-49 locus. Reference: Ruiz M, et al. Nat Commun. 2022 Nov 22;13(1):7162. doi: 10.1038/s41467-022-34931-0. PMID: 36418331.
PHX649 fat-6(syb649[fat-6::GFP]) IV. C. elegans GFP tag inserted into endogenous fat-6 locus using Crispr/Cas9. fat-6::GFP expression in intestine and hypodermis. No obvious phenotype, but the fat-6 locus is likely inactive in this strain. Reference: Bodhicharla R, et al. Genetics. 2018 Sep;210(1):189-201.
QC101 mnm-1(et1) etIs2 III. C. elegans etIs1 [ric-19p::ric-19::GFP + rol-6(su1006). Egl. Low levels of ric19::GFP fusion protein expression driven by the ric-19 promoter in all neurons except for strong expression in the pharyngeal M2 neurons. Nearly 90% of worms have defects in the distal ends of the pharyngeal M2 neurons.
QC102 etIs2 III; mnm-2(et2) X. C. elegans etIs1 [ric-19p::ric-19::GFP + rol-6(su1006). Low levels of ric19::GFP fusion protein expression driven by the ric-19 promoter in all neurons except for strong expression in the pharyngeal M2 neurons. Nearly 90% of worms have defects in the distal ends of the pharyngeal M2 neurons.
QC103 etIs2 III; mnm-3(et3) V. C. elegans etIs1 [ric-19p::ric-19::GFP + rol-6(su1006). Low levels of ric19::GFP fusion protein expression driven by the ric-19 promoter in all neurons except for strong expression in the pharyngeal M2 neurons. About 30% of worms have defects in the distal ends of the pharyngeal M2 neurons.
QC104 etIs2 III; mig-6(et4) V. C. elegans etIs1 [ric-19p::ric-19::GFP + rol-6(su1006). Low levels of ric19::GFP fusion protein expression driven by the ric-19 promoter in all neurons except for strong expression in the pharyngeal M2 neurons. 100% of worms have a twisted pharynx, which is easily seen as a twisted appearance of the M3 neurons.
QC105 etIs2 III; ten-1(et5) X. C. elegans etIs1 [ric-19p::ric-19::GFP + rol-6(su1006). Low levels of ric19::GFP fusion protein expression driven by the ric-19 promoter in all neurons except for strong expression in the pharyngeal M2 neurons. 10% of the worms have a pharyngeal M2 neuron cell body misplaced into the metacarpus.
QC114 etEx2. C. elegans etEx2 [glo-1p::GFP::ras-2 CAAX + rol-6(su1006)]. Rollers. Pick Rollers to maintain. etEx2 contains plasmid pQC09.6, which carries the ras-2 CAAX motif at the C-terminus of GFP; this array is a prenylation reporter. Reference: Mörck C, et al. Proc Natl Acad Sci U S A. 2009 Oct 27;106(43):18285-90.
QC115 atfs-1(et15) V. C. elegans Gain-of-function atfs-1 allele. Reference: Rauthan M, et al. Proc Natl Acad Sci U S A. 2013 Apr 9;110(15):5981-6.
QC116 atfs-1(et16) V. C. elegans Gain-of-function atfs-1 allele. Reference: Rauthan M, et al. Proc Natl Acad Sci U S A. 2013 Apr 9;110(15):5981-6.
QC117 atfs-1(et17) V. C. elegans Gain-of-function atfs-1 allele. Reference: Rauthan M, et al. Proc Natl Acad Sci U S A. 2013 Apr 9;110(15):5981-6.
QC118 atfs-1(et18) V. C. elegans Gain-of-function atfs-1 allele. Reference: Rauthan M, et al. Proc Natl Acad Sci U S A. 2013 Apr 9;110(15):5981-6.
QC119 ech-7(et6) I; paqr-2(tm3410) III. C. elegans paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. ech-7(et6) suppresses the cold-adaptation defect of paqr-2(tm3410) and partially suppresses the tail tip defect. ech-7(et6); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
QC120 nhr-49(et7) I; paqr-2(tm3410) III. C. elegans paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. nhr-49(et7) is a gain-of-function allele and suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. nhr-49(et7); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
QC121 nhr-49(et8) I; paqr-2(tm3410) III. C. elegans paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. nhr-49(et8) is a gain-of-function allele and suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. nhr-49(et8); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
QC122 paqr-2(tm3410) III; pcyt-1(et9) X. C. elegans paqr-2(tm3410) homozygotes are unable to grow at 15C and exhibit a withered tail tip phenotype at 20C and 25C. pcyt-1(et9) suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. paqr-2(tm3410); pcyt-1(et9) double mutants can be propagated at 15C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
QC123 paqr-2(tm3410) III; cept-1(et10) X. C. elegans paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. cept-1(et10) suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. paqr-2(tm3410); cept-1(et10) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
QC124 paqr-2(tm3410) III; cept-1(et11) X. C. elegans paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. cept-1(et11) suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. paqr-2(tm3410); cept-1(et11) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
QC125 paqr-2(tm3410) III; hacd-1(et12) V. C. elegans paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. hacd-1(et12) suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. paqr-2(tm3410); hacd-1(et12) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
QC126 nhr-49(et13) I; paqr-2(tm3410) III. C. elegans paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. nhr-49(et13) is a gain-of-function allele and suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. nhr-49(et13); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
QC127 mdt-15(et14) I; paqr-2(tm3410) III. C. elegans paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. mdt-15(et14) is a gain-of-function allele and suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. mdt-15(et14); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
QC128 paqr-1(tm3262) IV. C. elegans Superficially wild-type. paqr-1(tm3262) have an increased number of small lipid droplets when combined with paqr-2(tm3410) in double mutants. Reference: Svensson E, et al. PLoS One. 2011;6(6):e21343.
QC129 paqr-2(tm3410) III. C. elegans Small brood size, reduced adult length, reduced locomotion and reduced life span. Maintain at 25°C. Unable to grow at 15°C. Withered tail-tip phenotype at 20°C and 25°C. Reference: Svensson E, et al. PLoS One. 2011;6(6):e21343.
QC130 paqr-3(ok2229) IV. C. elegans Superficially wild-type. Slight decrease in brood size and locomotion speed. Reference: Svensson E, et al. PLoS One. 2011;6(6):e21343.
QC133 mig-6(sa580) V. C. elegans sa580 is a G-to-A transition that changes a glycine at position 965 to a glutamate in MIG-6. Reference: Jafari M, et al. (2010) Genetics 186:969-982.
QC134 nduf-7(et19) I. C. elegans Constitutively activated mitochondrial UPR and an extended lifespan. Reference: Rauthan M, et al. G3 (Bethesda). 2015 Jun 1. pii: g3.115.018598.
QC136 iglr-2(et34) III. C. elegans Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitive; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.
QC137 iglr-2(et37) III. C. elegans Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitve; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.
QC138 iglr-2(et38) III. C. elegans Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitve; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.
QC139 paqr-2(et35) III. C. elegans Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitive; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.
QC140 paqr-2(et36) III. C. elegans Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitve; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.
QC142 fld-1(et45) I; paqr-2(tm3410) mdt-15(et14) III. C. elegans No obvious phenotype. The fld-1 and mdt-15 mutations act as suppressors of paqr-2.
QC145 fld-1(et48) I; paqr-2(tm3410) mdt-15(et14) III. C. elegans No obvious phenotype. The fld-1 and mdt-15 mutations act as suppressors of paqr-2.
QC146 fld-1(et49) I; iglr-2(et34) III. C. elegans The fld-1 mutation acts as a suppressor of iglr-2 but the strain still displays weak version of the iglr-2 phenotypes including reduced growth in the presence of glucose or at 15°C, and occasionally produces a tail tip defect.
QC152 mdt-15(et14) III. C. elegans The mdt-15(et14) gain-of-function mutation has no obvious phenotype on its own but can act as a paqr-2 suppressor. The C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5’-GTGCCTCCAGATCCACAGCT-3’; mdt-15(et14) WT Fwd: 5’-GTGCCTCCAGATCCACAGCC-3’; mdt-15 Rev: 5’-CACCCATTGGAGCACCACT-3’. Annealing 65°C, expected product ~400 bp. Reference: Svensk E, et al. PLoS Genetics 9:e1003801. PMID: 24068966
QC153 fld-1(et46) I. C. elegans The fld-1(et46) loss-of-function mutation has no obvious phenotype on its own but can act as a paqr-2 suppressor. fld-1(et46) carries a mutation in the splice acceptor site of intron 4, i.e. G>A. It can be detected using PCR with annealing at 65°C and using the following primers: et46_WT: atcccccaaaaaacccaatttttttgtag; et46_mut:atcccccaaaaaacccaatttttttgtaa; et46_rev: CCGGAATTGAGACCACctggaac. Expected product size: 389. Reference: Ruiz M, et al. eLife 7:e40686. PMID: 30509349
QC154 paqr-2(tm3410) III; paqr-1(tm3262) IV. C. elegans This double mutant strain has a severely deformed tail tip and is intolerant of cold (will not grow then die at 15°C) and of dietary saturated fatty acids. Its cell membranes are rigid and rich in saturated fatty acids, and the strain has a small brood size, slow locomotion, permeable cells, autophagy defects as well as other phenotypes. References: Svensson E, et al. PLoS ONE 6(6):e21343. PMID: 21712952. Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093
QC155 nhr-49(et8) I; mdt-15(et14) III. C. elegans This double mutant strain contains an excess polyunsaturated fatty acids in its cell membranes accompanied by excess lipid peroxidation, cell permeability, increased autophagy and other defects. The nhr-49(et8) C9873765T [WS200] mutation can be detected by PCR using the following primers: nhr-49 Fwd: 5’-CAGATTATGATTCGTGATGCTAGA-3; nhr-49 WT Rev: 5’-GAGATGAAAGATGTTGCTGTAGAG-3; nhr-49 Mut Rev: 5’-GAGATGAAAGATGTTGCTGTAGAA-3’. Annealing 65°C, expected products ~300 bp. The mdt-15(et14) C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5’-GTGCCTCCAGATCCACAGCT-3’; mdt-15(et14) WT Fwd: 5’-GTGCCTCCAGATCCACAGCC-3’; mdt-15 Rev: 5’-CACCCATTGGAGCACCACT-3’. Annealing 65°C, expected product ~400 bp. Reference: Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093
QC156 acs-13(et54) nhr-49(et8) I; mdt-15(et14) III. C. elegans This triple mutant strain contains an excess polyunsaturated fatty acids in its cell membranes accompanied by excess lipid peroxidation, cell permeability, increased autophagy and other defects. The acs-13(et54) mutation (G125R) can be detected using PCR with the following primers: WT FWD: 5´CTA CCA GGG TGT TCG CCA TG 3; acs-13 mutant FWD: 5´CTA CCA GGG TGT TCG CCA TA 3; acs-13 REV: 5´TCA AAC TTG GGC ATT GCT CC 3´. Annealing 65°C, expected product 395 bp. The nhr-49(et8) C9873765T [WS200] mutation can be detected by PCR using the following primers: nhr-49 Fwd: 5’-CAGATTATGATTCGTGATGCTAGA-3; nhr-49 WT Rev: 5’-GAGATGAAAGATGTTGCTGTAGAG-3; nhr-49 Mut Rev: 5’-GAGATGAAAGATGTTGCTGTAGAA-3’. Annealing 65°C, expected products ~300 bp. The mdt-15(et14) C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5’-GTGCCTCCAGATCCACAGCT-3’; mdt-15(et14) WT Fwd: 5’-GTGCCTCCAGATCCACAGCC-3’; mdt-15 Rev: 5’-CACCCATTGGAGCACCACT-3’. Annealing 65°C, expected product ~400 bp. Reference: Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093
QC158 paqr-1(et52) IV. C. elegans paqr-1 gain-of-function allele. R109C amino acid substitution isolated in a paqr-2(tm3410) suppressor screen. PCR genotyping can be done with these primers: paqr-1 seq REV: TTTCCGTGTGCAGTGACCA; paqr1_WT_REV: TGCCCTCCCTTTTTACGGCG; paqr1_mut_REV: TGCCCTCCCTTTTTACGGCA. This yields a 441 bp product. Reference: Busayavalasa K, et al. PLoS Genet. 2020 Aug 4;16(8):e1008975. PMID: 32750056
QC159 cuc-1(syb1006) III. C. elegans cuc-1 null mutant. Grows well on standard media but has a slightly reduced brood size and ~10% of gonad arms show a migration defect. Reference: Zhang X, et al. Biometals. 2020 Jun;33(2-3):147-157. doi: 10.1007/s10534-020-00239-z. PMID: 32506305.
QC47 etIs2 III. C. elegans etIs1 [ric-19p::ric-19::GFP + rol-6(su1006). Low levels of ric19::GFP fusion protein expression driven by the ric-19 promoter in all neurons except for strong expression in the pharyngeal M2 neurons.
QC5 etIs1 IV. C. elegans etIs1 [ric-19p::ric-19::GFP + rol-6(su1006). Low levels of ric19::GFP fusion protein expression driven by the ric-19 promoter in all neurons except for strong expression in the pharyngeal M2 neurons.
QC82 etEx1. C. elegans etEx1 [rol-6(su1006) + W02H5.8(2kb)::GFP]. Pick Rollers to maintain. 2 kb fragment of W02H5.8 was cloned intoFire Lab vector pPD95.69. This strain has been used by the Worm Atlas to study the development of the intestine.

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
et1 Allele
et2 Allele substitution splice_site
et3 Allele
et4 Allele substitution
et5 Allele substitution nonsense
et15 Allele substitution
et16 Allele substitution
et17 Allele substitution
et18 Allele substitution
et6 Allele substitution
et7 Allele substitution
et8 Allele substitution
et9 Allele substitution
et10 Allele substitution nonsense
et11 Allele substitution splice_site
et12 Allele substitution
et13 Allele substitution
et14 Allele substitution
et19 Allele substitution nonsense