Laboratory Information
| Name | HBR View on WormBase |
|---|---|
| Allele designation | goe |
| Head | Henrik Philipp Bringmann |
| Institution | Technische Universitat Dresden |
| Address | Technische Universitat Dresden Tatzberg 47/49 Dresden 01307 Germany |
| Website | https://tu-dresden.de/cmcb/biotec/forschungsgruppen/bringmann# |
| Gene classes |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| AH5059 | let-23(zh131[FRT::let-23::FRT::GFP::LoxP::FLAG::let-23]) II. | C. elegans | CRISPR allele of endogenous let-23, which expresses let-23::GFP fusion protein and is susceptible for conditional knock-out via incorporated FRT sites with FLPase expression. Reference: Konietzka et al. 2019. Current Biology (accepted). |
| COP1622 | nas-38(knu568) X. | C. elegans | Increased movement quiescence during lethargus. knu568 is a specific in-frame deletion of the TSP1 domain. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| COP1635 | nas-38(knu579 ok3407) X. | C. elegans | Specific in-frame deletion of the astacin domain in ok3407 background suppresses increased quiescence from the ok3407 allele. Quiescence behavior in this strain is reverted to wild-type. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1000 | ceh-24(tm1103) V. | C. elegans | Flipping defective. Reference: Schwarz J & Bringmann H. eLife 2017;10.7554/eLife.24846. |
| HBR1021 | goeIs240. | C. elegans | goeIs240 [hsp-16.2p::flp-11::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Likely intergrated into LG I or LG III. Heat shock-induced over-expression of FLP-11 neuropeptide causes behavioral quiescence. Reference: Turek et al. eLife 2016;5:e12499. |
| HBR1077 | goeIs247. | C. elegans | goeIs247 [ceh-24p::GCaMP6s::mKate2::unc-54 3'UTR + unc-119(+)]. Reporter expresses calcium sensor GCaMP6s with expression control mKate2. Reference: Schwarz J & Bringmann H. eLife 2017;10.7554/eLife.24846. |
| HBR1110 | unc-119(ed3) III; goeIs257. | C. elegans | goeIs257 [nas- 38p::d1mGFP::nas-38 3'UTR + unc-119(+)]. Destabilized GFP expressed from the nas-38 promoter; especially visible in hypodermis and excretory system. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1261 | goeIs288. | C. elegans | goeIs288 [flp-11p::mKate2::unc-54 3'UTR + unc-119(+)]. Low copy number insertion. Integration site unknown, but likely not in LG II. Reference: Turek et al. eLife 2016;5:e12499. |
| HBR1549 | goeIs326. | C. elegans | goeIs326 [hsp-16.2p::nlp-29::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-29::SL2::mKate2 after heat shock causes increased quiescence in adults. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1896 | goeIs388. | C. elegans | goeIs388 [hsp-16.2p::cnc-1::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-1::SL2::mKate2 after heat shock causes increased quiescence in adults. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1897 | goeIs397. | C. elegans | goeIs397 [hsp-16.2p::cnc-10::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-10::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1899 | goeIs406. | C elegans | goeIs406 [hsp-16.2p::nlp-31::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-31::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1900 | goeIs408. | C. elegans | goeIs408 [hsp-16.2p::nlp-27::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-27::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1901 | goeIs407. | C. elegans | goeIs407 [hsp-16.2p::cnc-2::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-2::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1902 | goeIs409. | C. elegans | goeIs409 [hsp-16.2p::nlp-32::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-32::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1907 | goeIs410. | C. elegans | goeIs410 [hsp-16.2p::cnc-6::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-6::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR191 | goeIs5. | C. elegans | goeIs5 [nmr-1p::SL1::GCaMP3.35::SL2::unc-54 3'UTR + unc-119(+)]. Reporter allows visualization of several command interneurons. Reference: Schwarz J & Bringmann H. PLoS One. 2013 Sep 20;8(9):e75853. |
| HBR1911 | goeIs411. | C. elegans | goeIs411 [hsp-16.2p::cnc-4::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-4::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1912 | goeIs412. | C. elegans | goeIs412 [hsp-16.2p::cnc-7::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-7::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1914 | goeIs413. | C elegans | goeIs413 [hsp-16.2p::cnc-9::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-9::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1961 | goeIs431. | C. elegans | goeIs431 [hsp-16.2p::nlp-25::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-25::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR1971 | nlp-42(syb235) V. | C. elegans | Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type. Primers for crossing: Fwd: cgagacttttaaccccgtcg InFwd: aaagcccatgacttgctgaa Rev: gctcaggtggttagagggtt Wild-type bands: 580bp, 2652bp. Mutation band: 335bp. |
| HBR2025 | unc-119(ed3) III; goeEx711. | C. elegans | goeEx711 [nlp-42p::mGFP::unc-54 3'UTR + unc-119(+)]. Pick non-Unc to maintain. Construct contains 2000 bp of nlp-42 promoter upstream of start. Expression pattern is variable between worms. |
| HBR205 | goeIs22. | C. elegans | goeIs22 [mec-4p::SL1::GCaMP3.35::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Reporter allows visualization of several mechanosensitive neurons. Reference: Schwarz J & Bringmann H. PLoS One. 2013 Sep 20;8(9):e75853. |
| HBR2256 | goeEx737. | C. elegans | goeEx737 [flp-24p::SL1::GCaMP3.35-SL2::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. ALA-specific expression of GCaMP with an additional mKate marker for expression reference. Pick mKate+ to maintain. High transmission rate (>99%). Reference: Konietzka et al. 2019. Current Biology (accepted). |
| HBR227 | aptf-1(gk794) II. | C. elegans | Complete lack of behavioral quiescence during sleep. References: Turek et al. Current Biology, 2013, 23, 2215-2223. Turek et al. eLife 2016;5:e12499. |
| HBR2317 | nlp-8(syb762) IV. | C. elegans | syb762 is a 1076 bp deletion in nlp-8. Flanking sequences: taaaacccggaacc - acttcttgaacaactg Forward primer: TAAAAGCGGAGTAGCGTCCA Reverse primer: CAGATGGTCGGGTGATTTGA syb762 was generated in a mutant background and out-crossed to N2 to remove those background mutations. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| HBR232 | aptf-1(tm3287) II. | C. elegans | Complete lack of behavioral quiescence during sleep. Reference: Turek et al. Current Biology, 2013, 23, 2215-2223. |
| HBR2340 | flp-11(syb1445[flp-11::SL2::unc-58(L428F)::linker::mKate2]) X. | C elegans | unc-58(L428F) was knocked into the endogenous locus of flp-11 to express a sodium channel in RIS that causes strong overactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665. |
| HBR4 | goeIs3. | C. elegans | goeIs3 [myo-3p::SL1::GCamP3.35::SL2::unc54 3'UTR + unc-119(+)]. Reporter expresses the calcium indicator GCaMP3 in all body wall muscles. Reference: Schwarz J, et al. Worm. 2012 Jan 1;1(1):12-4. |
| HBR507 | flp-11(tm2706) X. | C. elegans | 70% reduction of behavioral quiescence during sleep. Reference: Turek et al. eLife 2016;5:e12499. |
| HBR546 | goeIs102. | C. elegans | goeIs102 [aptf-1 5'UTR::ChR2::mKate2::aptf-1 3'UTR + unc-119(+)]. Superficially wild-type. This strain carries an optogenetic transgene that can be used to send worms to sleep immediately at any given time point. Reference: Turek M, et al. Curr Biol. 2013 Nov 18;23(22):2215-2223. |
| HBR762 | C10C6.7(goe3) IV. | C. elegans | goe3 is a 25 bp deletion in the second exon causing a frame shift and presumptive molecular null allele. sgRNA target sequence: GTTATGGTGAGAAGGAAAGCtgg Reference: Turek et al. eLife 2016;5:e12499. |
| HBR764 | C10C6.7(goe5) IV. | C. elegans | goe5 is a 4 bp deletion in the second exon causing a frame shift and presumptive molecular null allele. sgRNA target sequence: GTTATGGTGAGAAGGAAAGCtgg Reference: Turek et al. eLife 2016;5:e12499. |
| HBR914 | lim-6(tm4836) X. | C. elegans | Complete lack of behavioral quiescence during sleep. Reference: Turek et al. eLife 2016;5:e12499. |
| HBR986 | unc-119(ed3) III; goeEx361. | C. elegans | goeEx361 [ceh-24p::ReaChr::mKate2::unc-54 3'UTR + unc-119(+)]. Pick non-Unc to maintain. Reporter expresses ReaChr with expression control mKate2. Reference: Schwarz J & Bringmann H. eLife 2017;10.7554/eLife.24846. |
| PHX1364 | hsp-12.6(syb1364[hsp-12.6::mKate2]) IV. | C. elegans | mKate2 tag was inserted into the endogenous hsp-12.6 locus using CRISPR/Cas9. HSP-12.6::mKate2 expression most visible in the muscles. Reference: Koutsoumparis A, et al. Curr Biol. 2022 Apr 26;S0960-9822(22)00581-4. doi: 10.1016/j.cub.2022.04.012. PMID: 35504281 |
| PHX1433 | flp-11(syb1433[flp-11::SL2::egl-23(cDNA)(A383V)::linker::mKate2]) X. | C elegans | egl-23 cDNA(A383V) was knocked into the endogenous locus of flp-11 to express a potassium channel in RIS that causes moderate inactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665. |
| PHX1446 | nlp-8(syb762) I; nlp-32(syb431) cnc- 6(syb393) III, Y43C5A.3(syb761) IV; sybDf2 sybDf1 cnc-10(syb937) nlp-25(syb579) cnc-7(syb558) V. | C. elegans | Reduced survival after wounding. PHX1446 carries knockouts of 19 members of the nlp and cnc peptide families. sybDf1 is a deletion of a gene cassette including nlp-34, nlp-31, nlp-30, nlp-29, nlp-28, and nlp-27. sybDf2 is a deletion of a gene cassette including cnc-11, cnc-1, cnc-5, cnc-4, cnc-3, and cnc-2. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| PHX1464 | flp-11(syb1464[flp-11::SL2::egl-23(cDNA)(L229N)::linker::mKate2]) X. | C elegans | egl-23 cDNA(L229N) was knocked into the endogenous locus of flp-11 to express a potassium channel in RIS that causes strong inactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665. |
| PHX209 | R12G8.1(syb209) V. | C. elegans | Complete CRISPR/Cas-9 knock-out (1143bp deletion) of the gene R12G8.1. Homozygous. Superficial wild-type. Primers for crossing: Fwd: agctccggggacatcaaata InFwd: CTGAAAACTCGTCGTAGCCG Rev: tcagaggtccgtggttcaaa Wild-type bands: 402bp, 1427bp. Mutation band: 284bp. |
| PHX2193 | flp-11(syb2193[flp-11::SL2::mKate2::linker::twk-18(e1913)]) X. | C elegans | twk-18(e1913) was knocked into the endogenous locus of flp-11 to express a potassium channel in RIS that causes very strong inactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665. |
| PHX2493 | lgc-38(syb2346[flp-11p::dpy-10 site::flp-11 3’UTR] syb2493[ReaChR::linker::mKate2]) III. | C elegans | ReaChR expressed in RIS for optogenetic activation. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665. |
| PHX293 | nas-38(syb293) X. | C. elegans | Increased lethargus duration and increased movement quiescence during lethargus. syb293 is a clean C-terminal deletion starting from the same position where nas-38(ok3407) is truncated, removes a large part of the TSP domain. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| PHX3190 | lgc-38(syb2346[flp-11p::dpy-10 site::flp-11 3’UTR] syb3190[unc-58(e665)::linker(GSGSGSGSG)::mKate2]) III. | C elegans | flp-11p::unc-58(e665) was knocked into a SKI LODGE site to express a sodium channel in RIS that causes moderate over activation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665. |
| PHX3225 | jkk-1(syb3225) X. | C elegans | Putative jkk-1 gain-of-function allele. Reference: Busack I & Bringmann H. (2023). JKK-1(3E), a JKK-1 mutant with predicted phosphomimetic amino acid substitutions. microPublication Biology. 10.17912/micropub.biology.000785. |
| PHX530 | nlp-11(syb530) II. | C. elegans | Superficially wild-type. syb530 is a 2042 bp deletion of the entire nlp-11 gene. Flanking sequences: tatttctcctattgagtgcaaaaaagagtgaaa-acatcaacaaataaaataccataccaacgagt Primers for genotyping: Fwd: gtcctcaccattcccctagg Interal (fwd): TCTGATCGACGCTGGAAAGA Rev: gaataggaagagggcggagg PCR product: WT 264 bp / syb530 -- ; WT 2551 bp / syb530 509 bp. Reference: Konietzka J, et al. Curr Biol. 2020 Jan 6;30(1):1-16.e13. doi: 10.1016/j.cub.2019.10.048. PMID: 31839447 |
| PHX700 | ilys-4(syb700) IV. | C. elegans | Complete knock out of gene. Increased L1 arrest sleep/quiescence. Reference: Konietzka et al. 2019. Current Biology (accepted). |
This laboratory hasn't submitted any alleles to the CGC.