Laboratory Information

NameHBR View on WormBase
Allele designationgoe
HeadHenrik Philipp Bringmann
InstitutionTechnische Universitat Dresden, Germany
Address Technische Universitat Dresden
Tatzberg 47/49
Dresden 01307
Germany
Website https://tu-dresden.de/cmcb/biotec/forschungsgruppen/bringmann#
Gene classes

Strains contributed by this laboratory

Strain Genotype Species Description
AH5059 let-23(zh131[FRT::let-23::FRT::GFP::LoxP::FLAG::let-23]) II. C. elegans CRISPR allele of endogenous let-23, which expresses let-23::GFP fusion protein and is susceptible for conditional knock-out via incorporated FRT sites with FLPase expression. Reference: Konietzka et al. 2019. Current Biology (accepted).
COP1622 nas-38(knu568) X. C. elegans Increased movement quiescence during lethargus. knu568 is a specific in-frame deletion of the TSP1 domain. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
COP1635 nas-38(knu579 ok3407) X. C. elegans Specific in-frame deletion of the astacin domain in ok3407 background suppresses increased quiescence from the ok3407 allele. Quiescence behavior in this strain is reverted to wild-type. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1000 ceh-24(tm1103) V. C. elegans Flipping defective. Reference: Schwarz J & Bringmann H. eLife 2017;10.7554/eLife.24846.
HBR1021 goeIs240. C. elegans goeIs240 [hsp-16.2p::flp-11::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Likely intergrated into LG I or LG III. Heat shock-induced over-expression of FLP-11 neuropeptide causes behavioral quiescence. Reference: Turek et al. eLife 2016;5:e12499.
HBR1077 goeIs247. C. elegans goeIs247 [ceh-24p::GCaMP6s::mKate2::unc-54 3'UTR + unc-119(+)]. Reporter expresses calcium sensor GCaMP6s with expression control mKate2. Reference: Schwarz J & Bringmann H. eLife 2017;10.7554/eLife.24846.
HBR1110 unc-119(ed3) III; goeIs257. C. elegans goeIs257 [nas- 38p::d1mGFP::nas-38 3'UTR + unc-119(+)]. Destabilized GFP expressed from the nas-38 promoter; especially visible in hypodermis and excretory system. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1261 goeIs288. C. elegans goeIs288 [flp-11p::mKate2::unc-54 3'UTR + unc-119(+)]. Low copy number insertion. Integration site unknown, but likely not in LG II. Reference: Turek et al. eLife 2016;5:e12499.
HBR1549 goeIs326. C. elegans goeIs326 [hsp-16.2p::nlp-29::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-29::SL2::mKate2 after heat shock causes increased quiescence in adults. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1896 goeIs388. C. elegans goeIs388 [hsp-16.2p::cnc-1::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-1::SL2::mKate2 after heat shock causes increased quiescence in adults. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1897 goeIs397. C. elegans goeIs397 [hsp-16.2p::cnc-10::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-10::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1899 goeIs406. C elegans goeIs406 [hsp-16.2p::nlp-31::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-31::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1900 goeIs408. C. elegans goeIs408 [hsp-16.2p::nlp-27::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-27::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1901 goeIs407. C. elegans goeIs407 [hsp-16.2p::cnc-2::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-2::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1902 goeIs409. C. elegans goeIs409 [hsp-16.2p::nlp-32::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-32::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1907 goeIs410. C. elegans goeIs410 [hsp-16.2p::cnc-6::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-6::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR191 goeIs5. C. elegans goeIs5 [nmr-1p::SL1::GCaMP3.35::SL2::unc-54 3'UTR + unc-119(+)]. Reporter allows visualization of several command interneurons. Reference: Schwarz J & Bringmann H. PLoS One. 2013 Sep 20;8(9):e75853.
HBR1911 goeIs411. C. elegans goeIs411 [hsp-16.2p::cnc-4::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-4::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1912 goeIs412. C. elegans goeIs412 [hsp-16.2p::cnc-7::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-7::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1914 goeIs413. C elegans goeIs413 [hsp-16.2p::cnc-9::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-9::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1961 goeIs431. C. elegans goeIs431 [hsp-16.2p::nlp-25::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-25::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR1971 nlp-42(syb235) V. C. elegans Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type. Primers for crossing: Fwd: cgagacttttaaccccgtcg InFwd: aaagcccatgacttgctgaa Rev: gctcaggtggttagagggtt Wild-type bands: 580bp, 2652bp. Mutation band: 335bp.
HBR2025 unc-119(ed3) III; goeEx711. C. elegans goeEx711 [nlp-42p::mGFP::unc-54 3'UTR + unc-119(+)]. Pick non-Unc to maintain. Construct contains 2000 bp of nlp-42 promoter upstream of start. Expression pattern is variable between worms.
HBR205 goeIs22. C. elegans goeIs22 [mec-4p::SL1::GCaMP3.35::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Reporter allows visualization of several mechanosensitive neurons. Reference: Schwarz J & Bringmann H. PLoS One. 2013 Sep 20;8(9):e75853.
HBR2256 goeEx737. C. elegans goeEx737 [flp-24p::SL1::GCaMP3.35-SL2::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. ALA-specific expression of GCaMP with an additional mKate marker for expression reference. Pick mKate+ to maintain. High transmission rate (>99%). Reference: Konietzka et al. 2019. Curr Biol. 2020 Jan 6;30(1):1-16.e13. doi: 10.1016/j.cub.2019.10.048. PMID: 31839447.
HBR227 aptf-1(gk794) II. C. elegans Complete lack of behavioral quiescence during sleep. References: Turek et al. Current Biology, 2013, 23, 2215-2223. Turek et al. eLife 2016;5:e12499.
HBR2317 nlp-8(syb762) IV. C. elegans syb762 is a 1076 bp deletion in nlp-8. Flanking sequences: taaaacccggaacc - acttcttgaacaactg Forward primer: TAAAAGCGGAGTAGCGTCCA Reverse primer: CAGATGGTCGGGTGATTTGA syb762 was generated in a mutant background and out-crossed to N2 to remove those background mutations. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
HBR232 aptf-1(tm3287) II. C. elegans Complete lack of behavioral quiescence during sleep. Reference: Turek et al. Current Biology, 2013, 23, 2215-2223.
HBR2340 flp-11(syb1445[flp-11::SL2::unc-58(L428F)::linker::mKate2]) X. C elegans unc-58(L428F) was knocked into the endogenous locus of flp-11 to express a sodium channel in RIS that causes strong overactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
HBR3216 lgc-38(goe13[flp-11p::XCaMP-R::flp-11 3’UTR] *syb2346) III; flp-11(syb6321[flp-11::sfGFP] *syb714) X. C. elegans sfGFP tag inserted at C-terminus of endogenous flp-11 locus. FLP-11sfGFP translational reporter is visible in RIS and together with XCaMP-R allows visualization of RIS activity and FLP-11 release. [syb6321 sgRNA1: GCTACCATAGGCACCACGAGCGG.] [goe13 dpy-10 crRNA: Gctaccataggcaccacgag. trRNA: aacagcauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.] Reference: Park B, et al. Sci Adv. DOI: 10.1126/sciadv.adv8387 PMID:
HBR4 goeIs3. C. elegans goeIs3 [myo-3p::SL1::GCamP3.35::SL2::unc54 3'UTR + unc-119(+)]. Reporter expresses the calcium indicator GCaMP3 in all body wall muscles. Reference: Schwarz J, et al. Worm. 2012 Jan 1;1(1):12-4.
HBR507 flp-11(tm2706) X. C. elegans 70% reduction of behavioral quiescence during sleep. Reference: Turek et al. eLife 2016;5:e12499.
HBR546 goeIs102. C. elegans goeIs102 [aptf-1 5'UTR::ChR2::mKate2::aptf-1 3'UTR + unc-119(+)]. Superficially wild-type. This strain carries an optogenetic transgene that can be used to send worms to sleep immediately at any given time point. Reference: Turek M, et al. Curr Biol. 2013 Nov 18;23(22):2215-2223.
HBR762 C10C6.7(goe3) IV. C. elegans goe3 is a 25 bp deletion in the second exon causing a frame shift and presumptive molecular null allele. sgRNA target sequence: GTTATGGTGAGAAGGAAAGCtgg Reference: Turek et al. eLife 2016;5:e12499.
HBR764 C10C6.7(goe5) IV. C. elegans goe5 is a 4 bp deletion in the second exon causing a frame shift and presumptive molecular null allele. sgRNA target sequence: GTTATGGTGAGAAGGAAAGCtgg Reference: Turek et al. eLife 2016;5:e12499.
HBR914 lim-6(tm4836) X. C. elegans Complete lack of behavioral quiescence during sleep. Reference: Turek et al. eLife 2016;5:e12499.
HBR986 unc-119(ed3) III; goeEx361. C. elegans goeEx361 [ceh-24p::ReaChr::mKate2::unc-54 3'UTR + unc-119(+)]. Pick non-Unc to maintain. Reporter expresses ReaChr with expression control mKate2. Reference: Schwarz J & Bringmann H. eLife 2017;10.7554/eLife.24846.
PHX1364 hsp-12.6(syb1364[hsp-12.6::mKate2]) IV. C. elegans mKate2 tag was inserted into the endogenous hsp-12.6 locus using CRISPR/Cas9. HSP-12.6::mKate2 expression most visible in the muscles. Reference: Koutsoumparis A, et al. Curr Biol. 2022 Apr 26;S0960-9822(22)00581-4. doi: 10.1016/j.cub.2022.04.012. PMID: 35504281
PHX1433 flp-11(syb1433[flp-11::SL2::egl-23(cDNA)(A383V)::linker::mKate2]) X. C elegans egl-23 cDNA(A383V) was knocked into the endogenous locus of flp-11 to express a potassium channel in RIS that causes moderate inactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
PHX1446 nlp-8(syb762) I; nlp-32(syb431) cnc- 6(syb393) III, Y43C5A.3(syb761) IV; sybDf2 sybDf1 cnc-10(syb937) nlp-25(syb579) cnc-7(syb558) V. C. elegans Reduced survival after wounding. PHX1446 carries knockouts of 19 members of the nlp and cnc peptide families. sybDf1 is a deletion of a gene cassette including nlp-34, nlp-31, nlp-30, nlp-29, nlp-28, and nlp-27. sybDf2 is a deletion of a gene cassette including cnc-11, cnc-1, cnc-5, cnc-4, cnc-3, and cnc-2. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
PHX1464 flp-11(syb1464[flp-11::SL2::egl-23(cDNA)(L229N)::linker::mKate2]) X. C elegans egl-23 cDNA(L229N) was knocked into the endogenous locus of flp-11 to express a potassium channel in RIS that causes strong inactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
PHX1965 nlp-29(syb1965[nlp-29::linker::mKate2]) V. C. elegans Endogenous locus tagged with mKate2 using CRISPR/Cas9. Enables visualisation of this secreted AMP in the cuticle upon genetic or physical cuticle damage. Reference: Pujol N & Bringmann H. 2025. microPublication Biology. A knock-in translational reporter for NLP-29 reveals AMP secretion to the apical extracellular matrices following epidermal damage in Caenorhabditis elegans. 10.17912/micropub.biology.001435.
PHX209 R12G8.1(syb209) V. C. elegans Complete CRISPR/Cas-9 knock-out (1143bp deletion) of the gene R12G8.1. Homozygous. Superficial wild-type. Primers for crossing: Fwd: agctccggggacatcaaata InFwd: CTGAAAACTCGTCGTAGCCG Rev: tcagaggtccgtggttcaaa Wild-type bands: 402bp, 1427bp. Mutation band: 284bp.
PHX2193 flp-11(syb2193[flp-11::SL2::mKate2::linker::twk-18(e1913)]) X. C elegans twk-18(e1913) was knocked into the endogenous locus of flp-11 to express a potassium channel in RIS that causes very strong inactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
PHX2457 dmsr-7(syb2457) V. C. elegans Molecular null allele. syb2457 is a CRISPR-engineered deletion of the entire dmsr-7 coding region. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
PHX2493 lgc-38(syb2346[flp-11p::dpy-10 site::flp-11 3’UTR] syb2493[ReaChR::linker::mKate2]) III. C elegans ReaChR expressed in RIS for optogenetic activation. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
PHX293 nas-38(syb293) X. C. elegans Increased lethargus duration and increased movement quiescence during lethargus. syb293 is a clean C-terminal deletion starting from the same position where nas-38(ok3407) is truncated, removes a large part of the TSP domain. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
PHX3190 lgc-38(syb2346[flp-11p::dpy-10 site::flp-11 3’UTR] syb3190[unc-58(e665)::linker(GSGSGSGSG)::mKate2]) III. C elegans flp-11p::unc-58(e665) was knocked into a SKI LODGE site to express a sodium channel in RIS that causes moderate over activation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
PHX3225 jkk-1(syb3225) X. C elegans Putative jkk-1 gain-of-function allele. Reference: Busack I & Bringmann H. (2023). JKK-1(3E), a JKK-1 mutant with predicted phosphomimetic amino acid substitutions. microPublication Biology. 10.17912/micropub.biology.000785.
PHX4021 nlp-99(syb4021) II. C. elegans nlp-99 is the C. elegans homolog of somatostatin/allatostatin C. syb4021 is a CRISPR-engineered deletion removing 85 bp of the first exon of T05A8.3.1 coding sequence and introducing two stop codons. Increased sleep during L1 arrest and adult starvation; decreased sleep in fed adult. Increased L1 arrest survival and fed adult lifespan. Increased lipid storage during L1 arrest. Adult memory defective. Forward primer: CTTCAACCTTCTAAGCCGCG. Reverse primer: TCTTAAGCCTGGCCCTAACC. sgRNA1: ccactagaataATGGCATCCTCC. sgRNA2: CGCGGGCCGAATTATACCACAGg. repair template: gcgtgcacaacttttcctgtgtgcctgtgtgctgctccactagaataATG-TAATAGCACAGgtgagaatctacaaaaaattgagcttaaattccctaaaa. Reference: Park B, et al. Sci Adv. DOI: 10.1126/sciadv.adv8387 PMID:
PHX4792 nlp-99(syb4792[nlp-99::SL2::mKate2]) II. C. elegans SL2::mKate2 tag inserted at C-terminus of endogenous nlp-99 locus. Transcriptional reporter of C. elegans homolog of somatostatin/allatostatin C is expressed in several neurons: AIYs (L1 and adult), DVC (L1 and adult), RIS (L1 and adult), DVB (adult). sgRNA1: CCACTCAGCTGCCTGCTCAAACG. sgRNA2: CCTGCTCAAACGACGACGACGAT. Reference: Park B, et al. Sci Adv. DOI: 10.1126/sciadv.adv8387 PMID:
PHX4879 nlp-99(syb4879[nlp-99::linker::mKate2]) II. C. elegans mKate2 tag with flexible linker inserted at C-terminus of endogenous nlp-99 locus. Translational reporter of C. elegans homolog of somatostatin/allatostatin C. Expression is mostly diffuse in the animal (around the pharynx) with localization in coelomocytes; little signal in neurons. sgRNA1: CCACTCAGCTGCCTGCTCAAACG. sgRNA2: CCTGCTCAAACGACGACGACGAT. Reference: Park B, et al. Sci Adv. DOI: 10.1126/sciadv.adv8387 PMID:
PHX530 nlp-11(syb530) II. C. elegans Superficially wild-type. syb530 is a 2042 bp deletion of the entire nlp-11 gene. Flanking sequences: tatttctcctattgagtgcaaaaaagagtgaaa-acatcaacaaataaaataccataccaacgagt Primers for genotyping: Fwd: gtcctcaccattcccctagg Interal (fwd): TCTGATCGACGCTGGAAAGA Rev: gaataggaagagggcggagg PCR product: WT 264 bp / syb530 -- ; WT 2551 bp / syb530 509 bp. Reference: Konietzka J, et al. Curr Biol. 2020 Jan 6;30(1):1-16.e13. doi: 10.1016/j.cub.2019.10.048. PMID: 31839447
PHX5866 flp-11(syb5866) X. C. elegans Molecular null allele. syb5866 is a CRISPR-engineered deletion of the entire flp-11 coding region. Strongly reduces sleep. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
PHX6265 lgc-38(syb6265[flp-11p::FLP D5::flp-11 3’UTR] *syb2346) III. C. elegans (III:7007600). FLP D5 recombinase driver expressed from the flp-11 promoter. The flp-11p::FLP driver consistently causes recombination in RIS, as well as in several other cell types. It is more penetrant but less specific than srx-9(syb7929[srx-9::SL2::FLP D5]). Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
PHX6333 dmsr-1(syb6331 syb6333[FRT::dmsr-1 exons 2-3::FRT]) V. C. elegans Conditional knockout of dmsr-1 created via consecutive insertion of two FRT sites (GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC) flanking the second and third exons. The sequence within the two FRT sites is predicted to encode the first four transmembrane alpha helices. FLP recombination excises this sequence and introduces a frameshift, resulting in a likely molecular null allele of dmsr-1. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
PHX700 ilys-4(syb700) IV. C. elegans Complete knock out of gene. Increased L1 arrest sleep/quiescence. Reference: Konietzka et al. 2019. Current Biology (accepted).
PHX7929 srx-9(syb7929[srx-9::SL2::FLP D5]) V. C. elegans FLP D5 recombinase expressed from the srx-9 locus. The srx-9::SL2::FLP driver caused recombination in RIS in most of the individuals, with no recombination detected outside of RIS. It is less penetrant but more specific than syb2346 syb6265[flp-11p::FLP D5::flp-11 3’UTR]. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
PHX8025 nmr-1(syb8025[nmr-1::SL2::FLP D5]) II. C. elegans FLP D5 recombinase driver expressed from the nmr-1 locus. nmr-1::SL2::FLP causes recombination in command interneurons including AVA, AVD, AVE, RIM, AVG, PVCs. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
PHX8127 srm-1(syb8127[unc-25p(fragment)::SL1-aaaa::FLP D5::let-858 3’UTR]) IV. C. elegans srm-1(syb8127[dpy-10 sgRNAsite::unc-25 fragment with tataa sites::dpy-10 sgRNAsite::SL1-aaaa::FLP D5::let-858 3’utr]) (IV:5015000). FLP D5 recombinase driver expressed from a fragment of the unc-25 promoter that expresses in RME neurons. Recombination was only modestly penetrant. Promoter construct contains dpy-10 sites allowing for a straightforward exchange of the promoter. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
PHX9007 unc-4(syb9007[unc-4::SL2::FLP D5]) II. C. elegans FLP D5 recombinase driver expressed from the unc-4 locus. unc-4::SL2::FLP causes recombination specifically in Dorsal A-type motor neurons, SABs neurons and I5. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
PHX9032 npr-16(syb9032[npr-16::sl2::tdStayGold]) X. C. elegans SL2::tdStayGold tag inserted at C-terminus of endogenous npr-16 locus. Transcriptional reporter of C. elegans homolog of somatostatin/allatostatin C receptor is expressed in several neurons, including in RIS. Reference: Park B, et al. Sci Adv. DOI: 10.1126/sciadv.adv8387 PMID:
This laboratory hasn't submitted any alleles to the CGC.