Laboratory Information
Name | CER View on WormBase |
---|---|
Allele designation | cer |
Head | Julian Ceron |
Institution | Fundacion IDIBELL, Barcelona, Spain |
Address | Hospital Duran i Reynals, Planta 3. IDIBELL-Laboratorio de Genetica Molecular Gran via 199 Hospitalet de Llobregat 08908 Spain |
Website | http://www.gusano.info/ceronlab |
Gene classes | sftb |
Strains contributed by this laboratory
Strain | Genotype | Species | Description |
---|---|---|---|
CER123 | ham-3(he159) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I; III). | C. elegans | Heterozygotes are WT, GFP+ in the pharynx and segregate WT (GFP+ in the pharynx), dead eggs (homozygotes for hT2) and ham-3(he159) homozygotes, which are Sma, Egl, Adl, Pvl. Maintain by picking GFP+ worms and checking for correct segregation, since the hT2 balancer is lost at low frequencies. he159 allele was isolated by John Satterlee from a deletion library at Sander van den Heuvel's lab. Reference: Ertl I, et al. Genetics. 2016 Mar;202(3):961-75. |
CER162 | unc-119(ed3) III; cerIs7. | C. elegans | cerIs7 [lsm-1::GFP(fosmid) + unc-119(+)]. cerIs7 rescues all the temperature-sensitive phenotypes of lsm-1(tm3585). Reporter contains full-length lsm-1 tagged with GFP. GFP was inserted into a fosmid containing lsm-1. GFP is expressed diffusely in the cytoplasm of somatic cells. Under heat shock conditions, GFP accumulates forming cytoplasmic foci. Reference: Cornes E, et al. RNA. 2015 Sep;21(9):1544-53. |
CER178 | nfki-1(cer1) X. | C. elegans | cer1 is a CRISPR-generated 368 bp deletion removing intron 2 and part of exon 3, creating a premature stop codon. Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153. |
CER187 | nfki-1(cer2) X. | C. elegans | cer2 is a CRISPR-generated 438 bp deletion + 50 bp insertion removing intron 2 and part of exon 3, creating a premature stop codon. Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153. |
CER244 | ikb-1(cer9) I. | C. elegans | cer9 is a CRISPR-generated 462 bp deletion at the beginning of the ikb-1 coding sequence, including the start codon (no transcript should be synthesized). Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153. |
CER348 | trxr-1(cer35[Sec666C]) IV. | C. elegans | Missense mutation selenocysteine to cysteine. Resistant to cisplatin exposure. Primers to genotype this missense mutation and other silent mutations: [Common Fw: GGCTTCCACATTCTCACTCC] [RV wildtype: CTTAACCTCAGCAACCAGAA] [RV Sec to Cys: CTTAACCGCAACATCCGCTG] Reference: García-Rodríguez FJ, et al. Dis Model Mech. 2018 Jun 21;11(6). |
CER36 | lsm-1(tm3585) II; lsm-3(tm5166) IV. | C. elegans | Maintain at 15C. Temperature sensitive. Reduced brood size, Sma. Reference: Cornes E, et al. RNA. 2015 Sep;21(9):1544-53. |
CER374 | trxr-1(cer55[Sec666X]) IV. | C. elegans | Missense mutation engineered by CRISPR removes a selenocysteine to place a stop codon. Resistance to cisplatin exposure. Primers to genotype the cer55 and other silent mutations: [Common Fw: #1224 GGCTTCCACATTCTCACTCC] [RV wildtype: #1414 cTTAACCTCAGCAACCAGAA] [RV Sec to STOP: #1421 CTTAACCTTAACATCCGCTG] Reference: García-Rodríguez FJ, et al. Dis Model Mech. 2018 Jun 21;11(6). |
CER4 | rsr-2(tm2625)/mIn1 [dpy-10(e128) mIs14] II. | C. elegans | mIs14 [myo-2::GFP]. Heterozygotes are WT and GFP+ with signal in the pharynx. Heterozygote animals segregate heterozygotes (WT GFP+), mIn1 homozygotes (Dpy and brighter GFP+), and rsr-2(tm2625) homozygotes (Lva non-GFP). Pick WT GFP+ animals and check for proper segregation of progeny to maintain. Reference: Fontrodona L, et al. PLoS Genet. 2013 Jun;9(6):e1003543. |
CER41 | unc-119(ed3) III; cerIs2. | C. elegans | cerIs2 [lsm-4p::lsm-4::GFP::lsm-4 3'UTR + unc-119(+)]. Reporter contains full-length lsm-4 tagged with GFP. GFP was inserted into a fosmid containing lsm-4. Ubiquitous nuclear GFP expression in somatic and germ cells under normal growth conditions. Cytoplasmic GFP accumulation after exposure to heat-shock. Reference: Cornes E, et al. RNA. 2015 Sep;21(9):1544-53. |
CER444 | sftb-1(cer114[mCherry::sftb-1]) III. | C. elegans | Endogenous sftb-1 reporter generated by CRISPR/Cas9 using the Nested CRISPR protocol (Vicencio et al., 2019 Genetics). mCherry was amplified from pJJR83 plasmid and inserted at the 5' end of the sftb-1 gene. External primers used for genotyping: (For: AGCTATCGAAGTTTAGGATGTTGTT) (Rev: CGGTTCCAATCGAGTCTAGGTA) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464. |
CER461 | nfki-1(cer116[eGFP::nfki-1]) X. | C. elegans | eGFP tag inserted into the endogenous nfki-1 locus. eGFP::NFKI-1 signal is observed in diverse neurons in the animals' head and tail throughout post-embryonic development. No obvious phenotype. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153. |
CER529 | sftb-1(cer144) III. | C. elegans | Dose-dependent sensitivity (developmental arrest) to pladienolide B and herboxidiene (modulators of pre-mRNA splicing). sftb-1(cer144[S1090A, A1095T, I1096V, F1101Y]) contains four missense mutations reproducing the HEAT repeat 15 of the human SF3B1 protein. Ten silent mutations increase primer specificity for PCR genotyping. Primers used for genotyping: (WT For: GAGCTGCAATTAATACATTTGGATTT) (WT Rev: AAACTCGCATTCCTTCACAT) (cer144 For: GGTACTATTCTGTGGCGTCT) (cer144 Rev: GTAACCGAAAGTGTTCACAGTT) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464. |
CER7 | rsr-2(tm2607) II. | C. elegans | Superficially wild-type. tm2607 is a 196 bp deletion + 1bp insertion that removes part of an essential gene, but produces viable animals. Reference: Fontrodona L, et al. PLoS Genet. 2013 Jun;9(6):e1003543. |
PHX267 | ikb-1(syb267[ikb-1::mCherry]) I. | C. elegans | mCherry tag inserted into the endogenous ikb-1 locus. IKB-1::mCherry is observed in the pharynx and body wall muscles during development. No obvious phenotype. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153. |
This laboratory hasn't submitted any alleles to the CGC.