Laboratory Information
| Name | CER View on WormBase |
|---|---|
| Allele designation | cer |
| Head | Julian Ceron |
| Institution | Fundacion IDIBELL, Barcelona, Spain |
| Address | Hospital Duran i Reynals, Planta 3. IDIBELL-Laboratorio de Genetica Molecular Gran via 199 Hospitalet de Llobregat 08908 Spain |
| Website | www.ceronlab.com |
| Gene classes | sftb |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| CER123 | ham-3(he159) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I; III). | C. elegans | Heterozygotes are WT, GFP+ in the pharynx and segregate WT (GFP+ in the pharynx), dead eggs (homozygotes for hT2) and ham-3(he159) homozygotes, which are Sma, Egl, Adl, Pvl. Maintain by picking GFP+ worms and checking for correct segregation, since the hT2 balancer is lost at low frequencies. he159 allele was isolated by John Satterlee from a deletion library at Sander van den Heuvel's lab. Reference: Ertl I, et al. Genetics. 2016 Mar;202(3):961-75. |
| CER162 | unc-119(ed3) III; cerIs7. | C. elegans | cerIs7 [lsm-1::GFP(fosmid) + unc-119(+)]. cerIs7 rescues all the temperature-sensitive phenotypes of lsm-1(tm3585). Reporter contains full-length lsm-1 tagged with GFP. GFP was inserted into a fosmid containing lsm-1. GFP is expressed diffusely in the cytoplasm of somatic cells. Under heat shock conditions, GFP accumulates forming cytoplasmic foci. Reference: Cornes E, et al. RNA. 2015 Sep;21(9):1544-53. |
| CER178 | nfki-1(cer1) X. | C. elegans | cer1 is a CRISPR-generated 368 bp deletion removing intron 2 and part of exon 3, creating a premature stop codon. Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153. |
| CER187 | nfki-1(cer2) X. | C. elegans | cer2 is a CRISPR-generated 438 bp deletion + 50 bp insertion removing intron 2 and part of exon 3, creating a premature stop codon. Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153. |
| CER240 | prp-8(cer22[R2303G]) III. | C. elegans | Partial loss of function allele. prp-8(cer22[R2303G]) point mutation mimics a mutation identified in a Retinitis Pigmentosa patient. Slow growth (Gro). Reference: Kukhtar D, et al. Hum Mol Genet. 2020 Mar 27;29(5):756-765. doi: 10.1093/hmg/ddz315. PMID: 31919495 |
| CER244 | ikb-1(cer9) I. | C. elegans | cer9 is a CRISPR-generated 462 bp deletion at the beginning of the ikb-1 coding sequence, including the start codon (no transcript should be synthesized). Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153. |
| CER248 | snrp-200(cer24[S1080L]) II. | C. elegans | Partial loss of function allele. snrp-200(cer24[S1080L]) point mutation mimics a mutation identified in a Retinitis Pigmentosa patient. Slow growth (Gro). Reference: Kukhtar D, et al. Hum Mol Genet. 2020 Mar 27;29(5):756-765. doi: 10.1093/hmg/ddz315. PMID: 31919495 |
| CER250 | ubh-4(cer25[F73V]) II. | C. elegans | Superficially wild-type. ubh-4(cer25[F73V]) is a missense mutation mimicking a human BAP1 cancer mutation. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270 |
| CER256 | snrp-200(cer23[V676L]) II. | C. elegans | Partial loss of function allele. snrp-200(cer23[V676L]) point mutation mimics a mutation identified in a Retinitis Pigmentosa patient. Reduced brood size, slow growth (Gro). Reference: Kukhtar D, et al. Hum Mol Genet. 2020 Mar 27;29(5):756-765. doi: 10.1093/hmg/ddz315. PMID: 31919495 |
| CER323 | ubh-4(cer27) II. | C. elegans | Reduced brood size. Genetic interaction with rpn-9. cer27 is a 1033 bp deletion removing the start codon and nearly all of the ubh-4 coding sequence. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270 |
| CER344 | ubh-4(cer32[A87D]) II. | C. elegans | Superficially wild-type. ubh-4(cer32[A87D]) is a missense mutation mimicking a human BAP1 cancer mutation. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270 |
| CER348 | trxr-1(cer35[Sec666C]) IV. | C. elegans | Missense mutation selenocysteine to cysteine. Resistant to cisplatin exposure. Primers to genotype this missense mutation and other silent mutations: [Common Fw: GGCTTCCACATTCTCACTCC] [RV wildtype: CTTAACCTCAGCAACCAGAA] [RV Sec to Cys: CTTAACCGCAACATCCGCTG] Reference: García-Rodríguez FJ, et al. Dis Model Mech. 2018 Jun 21;11(6). |
| CER36 | lsm-1(tm3585) II; lsm-3(tm5166) IV. | C. elegans | Maintain at 15C. Temperature sensitive. Reduced brood size, Sma. Reference: Cornes E, et al. RNA. 2015 Sep;21(9):1544-53. |
| CER374 | trxr-1(cer55[Sec666X]) IV. | C. elegans | Missense mutation engineered by CRISPR removes a selenocysteine to place a stop codon. Resistance to cisplatin exposure. Primers to genotype the cer55 and other silent mutations: [Common Fw: #1224 GGCTTCCACATTCTCACTCC] [RV wildtype: #1414 cTTAACCTCAGCAACCAGAA] [RV Sec to STOP: #1421 CTTAACCTTAACATCCGCTG] Reference: García-Rodríguez FJ, et al. Dis Model Mech. 2018 Jun 21;11(6). |
| CER4 | rsr-2(tm2625)/mIn1 [dpy-10(e128) mIs14] II. | C. elegans | mIs14 [myo-2::GFP]. Heterozygotes are WT and GFP+ with signal in the pharynx. Heterozygote animals segregate heterozygotes (WT GFP+), mIn1 homozygotes (Dpy and brighter GFP+), and rsr-2(tm2625) homozygotes (Lva non-GFP). Pick WT GFP+ animals and check for proper segregation of progeny to maintain. Reference: Fontrodona L, et al. PLoS Genet. 2013 Jun;9(6):e1003543. |
| CER41 | unc-119(ed3) III; cerIs2. | C. elegans | cerIs2 [lsm-4p::lsm-4::GFP::lsm-4 3'UTR + unc-119(+)]. Reporter contains full-length lsm-4 tagged with GFP. GFP was inserted into a fosmid containing lsm-4. Ubiquitous nuclear GFP expression in somatic and germ cells under normal growth conditions. Cytoplasmic GFP accumulation after exposure to heat-shock. Reference: Cornes E, et al. RNA. 2015 Sep;21(9):1544-53. |
| CER444 | sftb-1(cer114[mCherry::sftb-1]) III. | C. elegans | Endogenous sftb-1 reporter generated by CRISPR/Cas9 using the Nested CRISPR protocol (Vicencio et al., 2019 Genetics). mCherry was amplified from pJJR83 plasmid and inserted at the 5' end of the sftb-1 gene. External primers used for genotyping: (For: AGCTATCGAAGTTTAGGATGTTGTT) (Rev: CGGTTCCAATCGAGTCTAGGTA) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464. |
| CER461 | nfki-1(cer116[eGFP::nfki-1]) X. | C. elegans | eGFP tag inserted into the endogenous nfki-1 locus. eGFP::NFKI-1 signal is observed in diverse neurons in the animals' head and tail throughout post-embryonic development. No obvious phenotype. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153. |
| CER522 | ubh-4(cer140) rpn-9(gk401)/mIn1 [mIs14 dpy-10(e128)] II. | C. elegans | Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP cer140 gk401 homozygotes (synthetic sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. Generated by CRISPR-mediated deletion of ubh-4 in gk401 mutant background. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270 |
| CER529 | sftb-1(cer144) III. | C. elegans | Dose-dependent sensitivity (developmental arrest) to pladienolide B and herboxidiene (modulators of pre-mRNA splicing). sftb-1(cer144[S1090A, A1095T, I1096V, F1101Y]) contains four missense mutations reproducing the HEAT repeat 15 of the human SF3B1 protein. Ten silent mutations increase primer specificity for PCR genotyping. Primers used for genotyping: (WT For: GAGCTGCAATTAATACATTTGGATTT) (WT Rev: AAACTCGCATTCCTTCACAT) (cer144 For: GGTACTATTCTGTGGCGTCT) (cer144 Rev: GTAACCGAAAGTGTTCACAGTT) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464. |
| CER554 | comt-4(cer157[comt-4p::GFP::H2B]) V. | C. elegans | No obvious phenotype. comt-4(cer157) is a complete deletion of the comt-4 gene (coding sequence + introns), which was replaced by GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019), thereby creating a null allele and a transcriptional reporter at the same time. Reference: Martínez-Fernández C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130 |
| CER588 | cat-2(cer181[cat-2p::GFP::H2B 1-3]) II. | C. elegans | Abnormal locomotion can be rescued with dopamine. cat-2(cer181) is a complete deletion of the cat-2 gene (coding sequence + introns), which was substituted by the sequence of the step 1 repair for GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019). Allele can be detected using the following primers: Fwd: ctatgtgaagtcacacctgtc Rev: cttgctggaagtgtacttggtg. Reference: Martínez-Fernández C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130 |
| CER620 | ubh-4(cer68[ubh-4::eGFP]) rpn-9(cer203[rpn-9::wrmScarlet]) II | C. elegans | eGFP tag inserted into endogenous ubh-4 locus. wrmScarlet tag inserted into endogenous rpn-9 locus. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270 |
| CER660 | cer227[mex-5p::SpG(smu-2 introns) + unc-119(+)] II; unc-119(ed3) III. | C. elegans | Missense mutations D1135L and S1136W, G1218K and E1219Q, and R1335Q and T1337R were introduced on the Cas9 gene at EG9615 strain, to cause endogenous expression of the Cas9 variant SpG. SpG is efficient for CRISPR on NGN PAM sites. Reference: Vicencio J, et al. Nature Communication, 2022. May 12;13(1):2601. doi: 10.1038/s41467-022-30228-4. |
| CER7 | rsr-2(tm2607) II. | C. elegans | Superficially wild-type. tm2607 is a 196 bp deletion + 1bp insertion that removes part of an essential gene, but produces viable animals. Reference: Fontrodona L, et al. PLoS Genet. 2013 Jun;9(6):e1003543. |
| PHX267 | ikb-1(syb267[ikb-1::mCherry]) I. | C. elegans | mCherry tag inserted into the endogenous ikb-1 locus. IKB-1::mCherry is observed in the pharynx and body wall muscles during development. No obvious phenotype. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153. |
This laboratory hasn't submitted any alleles to the CGC.