Search Strains

More Fields
Strain Species Genotype Add
CB286 C. elegans unc-45(e286) III. Show Description
Slow moving Unc. Body muscle abnormal. Temperature sensitive. Recessive. M-MATING+POOR <1%WT.
DR94 C. elegans unc-45(m94) III. Show Description
Temperature sensitive Unc. Slow at 15C. Paralyzed at 20C and 25C.
RB703 C. elegans unc-45(ok468) III. Show Description
F30H5.1. Homozygous. Outer Left Sequence: CAGGTCCGAGCTCTAGTTGG. Outer Right Sequence: CTTTGAACACCTCAGGCCAT. Inner Left Sequence: CATTTCGAAAGCAACGATGA. Inner Right Sequence: CTGCCGAGTAGAGAACCCAG. Inner primer WT PCR product: 3017. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RW5031 C. elegans unc-45(b131) III. Show Description
RW5032 C. elegans unc-45(r450) III. Show Description
RW5033 C. elegans unc-45(su2002) III. Show Description
Temperature sensitive Unc.
LV13 C. elegans unc-45(wc4)/unc-45(e286) III. Show Description
Maintain this strain at 15C so that you can score for dead eggs (3 fold stage). At 15C, both hets and e286 homozygotes move reasonably well. Place single animals on plates and allow them to lay eggs for a day; then remove the parent and score the plates the next day for dead eggs. At 25C, both hets and e286 homozygotes will be Unc and Egl; dead eggs will remain inside the parent worm.
DR1799 C. elegans daf-7(n696)/unc-45(st604) III. Show Description
WT phenotype. Segregates WT, constitutive dauers and ts mild Uncs. Uncs are maternal-effect lethal: F1 Uncs from a heterozygote produce only arrested 2-fold stage progeny that hatch. Grow at 22.5C (n696 produces nearly 100% dauers at this temperature).
RW1329 C. elegans pat-12(st430)/unc-45(e286) III. Show Description
At 20C heterozygotes are WT and segregate WT, Uncs and PATs. st430 is a recessive lethal causing "mild" PAT phenotype. unc-45 is temperature sensitive (WT at 15C).
RW3550 C. elegans pat-4(st551)/unc-45(e286) III. Show Description
Heterozygotes are WT and segregate WT, Uncs (at 20C and 25C) and Pats. Maintain by picking WT at or above 20C. See also WBPaper00005261.
SP529 C. elegans unc-45(e286) dpy-1(e1) III. Show Description
Dpy. Unc (ts).
UP725 C. elegans mat-3(cs53)/unc-45(e286) III. Show Description
Heterozygotes are WT and segregate WT, Uncs, and Pvul which are sterile.
CB4035 C. elegans fem-2(e2105)/unc-45(r450) dpy-1(e1) III. Show Description
Heterozygotes are WT and segregate WT and DpyUnc. 1/3 of the WT are fem-2 homozygotes. Homozygous fem-2 animals are hermaphrodites if mother was heterozygous for fem-2, and are fertile females if mother was homozygous for fem-2.
DA675 C. elegans unc-45(r450) dpy-1(e1) phm-3(ad493) III. Show Description
Dpy. Unc (ts). Phm. Weak pharyngeal birefringence.
DP246 C. elegans unc-45(st601)/sC1 [dpy-1(s2170)] III. Show Description
Made from LV15. st601 is a non-conditional two-fold arrest lethal.
DR1228 C. elegans unc-45(e286) daf-7(e1372) dpy-1(e1) III. Show Description
Dpy. Temperature sensitive dauer constitutive (leaky). Temperature sensitive Unc. At 15C, Dpy adults and some dauers. At 25C, DpyUnc dauers and some DpyUnc adults (leakiness varies: 60-95% dauers).
LV15 C. elegans unc-45(st601)/daf-7(e1372) par-2(it46) III. Show Description
st601 is a non-conditional two-fold arrest lethal. Maintain at 25C to see daf-7 par-2 segregants (Daf-7(+) escapers will be Par). WT heterozygotes segregate WT, DafPar, 1/4 lethal eggs and two-fold arrest hatchlings. [3/97: dauers are not giving dead eggs-they are giving more dauers. The par-2 mutation may be lost.]
LV18 C. elegans unc-45(wc1) dpy-1(e1)/daf-7(e1372) par-2(it46) III. Show Description
Maintain at 25C. At 25C, heterozygotes are WT and segregate WT, Dauers (dauer escapers will be Par and give only dead eggs), and DpyUcs which arrest as dead eggs (range from twitching multicellulars to 3-folds that hatch). [There is a greater percentage of hatchlings when the mother is heterozygous (wc1 dpy-1/+). There may also be the possibility of near complete maternal rescue (near full-sized, sterile Dpys), but this has not been routinely observed in the balanced strain (as opposed to wc1 dpy-1/+).] Maintain by picking WT at 25C and scoring for correct segregation of progeny. [3/97: The dauers are not giving dead eggs-they are giving other dauers. Appears that the Par mutation is no longer present.]
LV19 C. elegans unc-45(wc2) dpy-1(e1)/daf-7(e1372) par-2(it46) III. Show Description
Maintain at 25C. At 25C, heterozygotes are WT and segregate WT, Dauers (escapers will be Par and give only dead eggs) and DpyUncs which are dead eggs (a range of embryonic lethality from multicellular twitchers to 3-folds that do not hatch). Maintain by picking WT at 25C and scoring for correct segregation of progeny. [3/97: the dauers are giving dead eggs.]
CYA11 C. elegans ldrIs1; eeeIs1. Show Description
ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. eeeIs1 [unc-54p::Htt513(Q15)::YFP::unc-45 3'UTR]. Derived by crossing parental strains LIU1 and EAK102. YFP is fused to a fragment of mutant human Huntingtin protein; expression in body wall muscle cells. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets.
EAK102 C. elegans eeeIs1. Show Description
eeeIs1 [unc-54p::Htt513(Q15)::YFP::unc-45 3'UTR]. YFP expression in body wall muscle cells. YFP is fused to a fragment of mutant human Huntingtin protein. Reference: Lee AL. et al. PLoS One. 2017 Mar 10;12(3):e0173644. [NOTE: The transgene in this strain was previously described as using the unc-45 promoter, but it is actually the unc-54 promoter.]
EAK103 C. elegans eeeIs2. Show Description
eeeIs2 [unc-54p::Htt513(Q128)::YFP::unc-45 3'UTR]. Motility defect. YFP expression in body wall muscle cells. YFP is fused to a fragment of mutant human Huntingtin protein. Reference: Lee AL. et al. PLoS One. 2017 Mar 10;12(3):e0173644. [NOTE: The transgene in this strain was previously described as using the unc-45 promoter, but it is actually the unc-54 promoter.]
RG3507 C. elegans orai-1(ve1007[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygous sterile. Deletion of 7387 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile GFP+ non-mKate2 (ve1007 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+.  orai-1 is near unc-45 and therefore near the outer limit of the sC1 balancer. Left flanking Sequence: ATCCTGACGTCAGAGATCTTCTGAAATCCG; Right flanking sequence: GTGTTCCGTCATGCCATTTTAATCTGTGTG. orai-1 crRNA A: CTTTCGAAGTCTCCGTTTCG; orai-1 crRNA B: GTGGCGAGACAGTGAGCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.