| CB315 |
C. elegans |
unc-34(e315) V. Show Description
Unc. Male spicules abnormal. Recessive. M-MATING-NO SUCCESS.
|
|
| CB566 |
C. elegans |
unc-34(e566) V. Show Description
Unc.
|
|
| LE983 |
C. elegans |
unc-34(lq17) V. Show Description
|
|
| OX977 |
C. elegans |
unc-34(gm104) V. Show Description
Unc. According to Withee (2004), gm104 has been sequenced and introduces an early amber stop at W24. Reference: Withee J, et al. Genetics. 2004 Jul;167(3):1165-76. PMID: 15280232
|
|
| KX10 |
C. elegans |
ife-3(ok191)/unc-34(e566) V. Show Description
At 20C heterozygotes segregate WT heterozygotes, Unc unc-34(e566) homozygotes, and Mog ife-3(ok191) homozygotes. At 25C ife-3(ok191) homozygotes are not always Mog, but progeny of the non-Mog homozygotes are embryonic lethal. Deletion of 686 bp from ife-3 removes proximal promoter and all of exon 1. Breakpoint determined by B. Keiper is: taattttcatattttccgct/tatcta/ttatcgattttttccagatg. Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 3; B0348.6); paralog of human eIF4E isoform.
|
|
| MT6185 |
C. elegans |
dpy-1(e1) III; unc-34(e566) V. Show Description
Mapping strain. Unc is ts.
|
|
| MT4446 |
C. elegans |
unc-34(e566) unc-60(e677) dpy-11(e224) V. Show Description
Dpy. Unc.
|
|
| QP218 |
C. elegans |
unc-34(e315) dpy-11(e224) rol-9(sc148) V. Show Description
Unc. Dpy. Rol(ts).
|
|
| JK1219 |
C. elegans |
unc-34(e315) lag-2(q387) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc. [Note from Kimble lab: Min Han did a complementation test on this strain and found that unc-34(e315) is lost from this strain.] Do not distribute this strain; other labs should request it from the CGC.
|
|
| DQM1152 |
C. elegans |
bmdSi243 I; ljf3(unc-34::mNG[C1]^3xFlag::AID*) V; qy41(lam-2::mKate2) X. Show Description
bmdSi243 (LoxN + cdh-3p::TIR1::F2A::DHB::2xmTurquoise2) I. bmdSi243 is a MosSCI insertion. mNG tag inserted into the C-temrinus of the endogenous unc-34 locus. mKate2 tag inserted into the C-temrinus of the endogenous lam-2 locus.
|
|
