Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
KR1341 C. elegans let-637(h700) dpy-5(e61) unc-13(e450) I; sDp2 (I;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in mid/late larval development.
OH7007 C. elegans ham-1(ot342) IV; vtIs1 vsIs33 V. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. Rollers. Fewer or extra cells expressing dat-1::GFP in various penetrances.
OH7008 C. elegans vtIs1 vsIs33 V; lin-32(ot343) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. vsIs33 [dop-3::RFP] V. Rollers. Fewer or extra cells expressing dat-1::GFP in various penetrances.
VH7000 C. elegans F21D5.6(hd7000[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Deletion of 964 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAAGCAGATTTTTTTCCAAAAAATGAGCT; Right flanking sequence: CGGATTCTGGTAATTTTGCAGGTTTAGTTT. sgRNA #1: GATTGATTTGGTTCCCTTCG; sgRNA #2: TTTTCTCGAATAACTCTCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7001 C. elegans gna-1(hd7001[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Deletion of 439 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATTAACGTGTGAAATTTAGAAGCGCTGAG; Right flanking sequence: AGGAATGTGTGGAGCTAACACAGACGCATC. sgRNA #1: TCATAAAATTGCAATCGTCC; sgRNA #2: AAATTGTCAGGAAGATTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.