Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC1315 C. elegans T10F2.4(gk575) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T10F2.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk575 homozygotes (sterile with no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACACGTCACCAATGAACGA. External right primer: CGTGGTGTCTCGAATTCCTT. Internal left primer: CATGTCGAAGGACAGGGAGT. Internal right primer: TTCGTTTATGTCCCACGTCA. Internal WT amplicon: 1565 bp. Deletion size: 632 bp. Deletion left flank: TGAATGTTTGCATAACCTGTTCCTTTTCAT. Deletion right flank: AGATAATTGCAAGGTTGACAAACCTGGTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG5045 C. elegans +/nT1 [umnIs49] IV; vha-13(gk5758[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5758 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4759 and CGC63. gk5758 is a 2243 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCCAGGAAAAGATGGCCGCAGAATCTTCG; Right flanking sequence: CGCTAGATTCTGTTCAGTTTTGCTGAGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5106 C. elegans +/mT1 [umnIs52] II; eif-3.D(gk5753[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Apparent homozygous lethal or sterile deletion balanced over labeled mT1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+ heterozygotes, GFP+ non-mKate2 gk5753 homozygotes, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. [NOTE: there is also red fluorescence apparent in the hypodermis or body wall.] Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4684 and CGC66. gk5753 is a deletion of 2118 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCGAATACAAGAAATTGTCAGAAACCGGGG. Right flanking sequence: GACGCCACCTCAATTTTTGGTTTTTATTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4681 C. elegans copb-2(gk5750[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3612 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAGAAAGCTTCTGGCTCGTTCGGACCGCGT. Right flanking sequence: CCCGTCCTATCAATGTCCCCATTCCATCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4682 C. elegans mdt-11(gk5751[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 634 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAAAATTGCAGTTATGGAGCCAAACCCATC. Right flanking sequence: TATGGAACAATGATCTCATTTTTATGTATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4683 C. elegans ran-5(gk5752[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1354 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CTTTCAAACCGTCTGCTTTAGCTGCCAAGG. Right flanking sequence: TCAAATCATTTCCCCTTAAGTCTAATTTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4684 C. elegans eif-3.D(gk5753[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2118 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. [NOTE: there is also red fluorescence apparent in the hypodermis.] Left flanking sequence: GCGAATACAAGAAATTGTCAGAAACCGGGG. Right flanking sequence: GACGCCACCTCAATTTTTGGTTTTTATTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4685 C. elegans R186.1(gk5754[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1708 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AACTGGACTTTCCAGTTTAAATAAGATGAA. Right flanking sequence: TTATCTATGTCAAACAATAACATTGTATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4686 C. elegans R119.3(gk5755[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 5306 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AAAATCTACAATCGATACGAGACTCCTCCT. Right flanking sequence: GACGGCTTTACCCAGTGTGGACGTTGCCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4687 C. elegans best-7(gk5756[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 3510 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAATAATCGTGATAATCAGAATGTTCTCCA. Right flanking sequence: TCGGTAGTTTGATAAATTTTACGACCCAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4688 C. elegans best-5(gk5757[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 3334 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATTGATTAAATTCTTAAATTAGAACCCGTT. Right flanking sequence: TTGGCATTTATTTGACGCCAAAAAATTTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4689 C. elegans vha-13(gk5758[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Show Description
[NOTE: Please see RG5045 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2243 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTCCAGGAAAAGATGGCCGCAGAATCTTCG. Right flanking sequence: CGCTAGATTCTGTTCAGTTTTGCTGAGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4690 C. elegans D2096.9(gk5759[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 957 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CACTTCACGCGAGCAGAACGCCCTTGCCTT. Right flanking sequence: TGCGGAAAAAATGCACACTCTTTGGTATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.