Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC46 C. elegans zig-3(gk33) X. Show Description
C14F5.2. Homozygous viable; deletion entirely in promoter. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1985 C. elegans F47G4.6(gk1056) I; daf-3(gk3330) X. Show Description
This strain is homozygous for a deletion (gk1056) in F47G4.6, detectable by PCR using the following primers. External left primer: CGCTTCTCCTGAGGTAGTGG. External right primer: GGACACTTCGAACCGGATTA. Internal left primer: ACGATGGATCGGTGTTTCTC. Internal right primer: AGCTGCCTAGCCTTCTCCTC. Internal WT amplicon: 1914 bp. Deletion size: 457 bp. Deletion left flank: TTAGCCTAAAAAATTTTTCCGAATTTTCTC. Deletion right flank: AGCTACCGTACTCATAAGCTACAGAGTGTA. Validation: gk1056 passed by diagnostic PCR and CGH. Other deletion (gk3330) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2012 C. elegans flp-27(gk3331) Y17G7B.22(gk1062) II; gkDf45 X. Show Description
This strain is homozygous for a deletion (gk1062) in Y17G7B.22, detectable by PCR using the following primers. External left primer: CCCGTAGTTCATCGATTGCT. External right primer: AAAAAGAATACCACCGGCCT. Internal left primer: ATCTGTTGCCTTCTGTTGGG. Internal right primer: TCGCAGGAGTTTGGGTACTT. Internal WT amplicon: 2119 bp. Deletion size: 1412 bp. Deletion left flank: AAATAGACTATTTCGGAAAATGGAAATGAG. Deletion right flank: AAAATTATTGATTTTGACCCCAAAAATTTA. Insertion Sequence: TTGT. Validation: gk1062 passed by diagnostic PCR and CGH. Other deletions (gk3331, gkDf45) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2368 C. elegans attf-5(gk1279) ceh-90(gk3396) X. Show Description
attf-5 homozygous viable deletion, detectable by nested PCR. ceh-90 homozygous viable deletion, identified by CGH. gk1279: External left primer: ctcccgaaaatccagcatta. External right primer: aactcatggaaaccgtcctg. Internal left primer: ccatagcaactgcgatgatg. Internal right primer: atgagcattagagcgcgatt. Internal WT amplicon: 2677 bp. Deletion breakpoints not determined; deletion of approximately 1030 bp narrowed to 1142-bp region between X coordinates 788497 and 789639 (WS279). Validation: gk1279 confirmed by CGH. gk3396: Left flanking probe AACAACAAACCTGAGCTTCGTTTCGATTCAATAAACCAGCAAGACGATTC; left deleted probe: ATAAACCAGCAAGACGATTCATTTCAGAAGTTCCAGGGTGTGAGTCTTTT; right deleted probe: ACAAGTTTTTCGGATGGAGAATTACCTAAAATGTCGATGAAAGATTATTG; right flanking probe: ATTGAGAGATAGAACCATAGAAAACACTAAATACGCAGATAGGTTATCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3254 C. elegans F38F1A.1(gk3300) II. Show Description
Y38F1A.1. External left primer: GCACCCCATTGTTGAACTTT. External right primer: ATGCCACGTAGCAAAAATCC. Internal left primer: TTCCCAAACACAAGAATCCC. Internal right primer: GCTAAGAGATATCGCGCGTC. Internal WT amplicon: 1616 bp. Deletion size: 493 bp. Deletion left flank: CTTCCCGGTGATTGTAAGGTCTTTAGACAT. Deletion right flank: TGTTTTTTATGTTGTTGTTTTTAAAATTGT. Validation: gk3300 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3287 C. elegans C08G9.2(gk3384)/nT1 IV; +/nT1 V. Show Description
C08G9.2. Apparent homozygous lethal deletion chromosome balanced by translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, vulvaless nT1 homozygotes, and gk3384 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCACAAGTTGGTACTGGGAGG. External right primer: CCATGCGAATTTTTGAACTGT. Internal left primer: ACAAGACCGTATGGGCAAAG. Internal right primer: ACCAATTTCATCTTGCCCTG. Internal WT amplicon: 1980 bp. Deletion size: 466 bp. Deletion left flank: GTCTGATCGTAGTTTCCATTTCTACTGCAT. Deletion right flank: GGTTTGATGTACATTCTACACGTCGAAGTG. Insertion Sequence: TTCTACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3288 C. elegans myrf-1(gk3366)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F59B10.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3366 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATCCATTTGAATCCTCGCTG. External right primer: AGCTTCCGATACAATGCCAC. Internal left primer: GTACCGGTGATTCGCTTTGT. Internal right primer: GAGCCGATCGTAAACCACAT. Internal WT amplicon: 1767 bp. Deletion size: 761 bp. Deletion left flank: TTACAAGATGGATTGAAGCATTTTTCAAGT. Deletion right flank: CGAATATCGGATGGATTGATTATTCGGCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3310 C. elegans srgp-1(gk3385)/nT1 IV; +/nT1 V. Show Description
F12F6.5. Apparent homozygous lethal deletion chromosome balanced by translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, vulvaless nT1 homozygotes, and gk3385 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GAAGTCACTTGAAGCATCAGAAAA. External right primer: TCAGAATCAAGCTTCTTTGTTGAG. Internal left primer: TCAAAAACCAATTTCGTTAGAGC. Internal right primer: TGATTTTTATTGCCTTTTTCCAA. Internal WT amplicon: 2179 bp. Deletion size: 980 bp. Deletion left flank: TATGTAGAAGCAACTGGAGAAGAAATTCCA. Deletion right flank: TTCAAAAATAGTTCATTATCATCCGAAGGA. Insertion Sequence: TAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3326 C. elegans W02B12.12(gk3362) II. Show Description
Homozygous viable, carrying a deletion in W02B12.12. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3327 C. elegans W03F9.1(gk3315) V/nT1 [qIs51] (IV;V). Show Description
W03F9.1. Homozygous lethal or sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3315 homozygotes (late larval arrest or sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAACAACGAACAACCGAGG. External right primer: GCGAAGAAGATGTAGGCGTC. Internal left primer: ATCGGTTTCTCGAGTCCTCC. Internal right primer: AACGAGATTCAAAGCGGAGA. Internal WT amplicon: 2151 bp. Deletion size: 836 bp. Deletion left flank: ACTTCCAGATCAATCTCAGGGATCGACAGA. Deletion right flank: CACTTGTGAATTGCTTAATAATCTGCAAAA. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3335 C. elegans srz-96(gk3364) V. Show Description
Homozygous viable, carrying a deletion in srz-96. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3364 C. elegans F37B12.3(gk3365)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F37B12.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3365 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAAATTTGCGTCAAAGTACGGT. External right primer: CCTATACACCTCTCATGCCTCC. Internal left primer: GGGTACCGTATTTTAGCGCA. Internal right primer: CCTGACGAATTGCCATCTTT. Internal WT amplicon: 2539 bp. Deletion size: 983 bp. Deletion left flank: GTGACAAGTTAAAGCGAATGGACCGAACAA. Deletion right flank: TGGAATTTAATAAAAATGTGTGGCTGTATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3366 C. elegans Y62E10A.10(gk3369) IV/nT1 [qIs51] (IV;V). Show Description
Y62E10A.10. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3369 homozygotes (sterile, flaccid). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATCTTTAAAGGCGCAGACGA. External right primer: GCAATGTGAACGTGGACAAC. Internal left primer: CACATTGACTTGATGGCTGG. Internal right primer: CCGATTTATTACTCGACCCG. Internal WT amplicon: 1660 bp. Deletion size: 617 bp. Deletion left flank: AGAGTGATTTTTTTTTAGACAAAAAAATTT. Deletion right flank: CCAGTTCCACCTGCAAGTATTTGTGGTTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3368 C. elegans ubl-5(gk3358) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F46F11.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3358 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCCCTCCGAAGAGAGCTTAT. External right primer: TCGCTGCCTAAACTTTTCGT. Internal left primer: ATTGCCCTTGGTCTGAAATG. Internal right primer: GTGCATGCGCCTTTAAGTTT. Internal WT amplicon: 1544 bp. Deletion size: 487 bp. Deletion left flank: GTTATTAATGTTTTTTCTCATGTAAAATAT. Deletion right flank: GTGATTTCAATCATTTTTCCTGAAAGGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3381 C. elegans srx-68(gk3547) nhr-195(gk3359) V. Show Description
Homozygous viable, carrying deletions in srx-68 and nhr-195. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3390 C. elegans rab-30(gk3322) III; pqn-53(gk3534) gkDf48 V. Show Description
This strain is homozygous for a deletion (gk3322) in Y45F3A.2, detectable by PCR using the following primers. External left primer: CACACTGGTCAAACTGTGCGT. External right primer: ACACAGTGTAGTAATTTGCGTCTCA. Internal left primer: TTTCTCTCGGTCAATTTCGACCT. Internal right primer: AGCGGATTGAGATTGACTGGCTA. Internal WT amplicon: 2596 bp. Deletion size: 1434 bp. Deletion left flank: AAAATGAGGTTAGAAAGTAAAAAAATGCGA. Deletion right flank: TGAACGGTTTGTGGATTTTTTGTAGGAAAT. Validation: gk3322 passed by CGH. Other deletions (gk3534, gkDf48) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3454 C. elegans +/szT1[lon-2(e678)] I; ceh-89(gk3340)/szT1 X. Show Description
F28H6.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and gk3340 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTGGCGGAAGGTGATTTTTA. External right primer: GGAGTCAGTGAAAATGGGGA. Internal left primer: AGGCAGATCAAACACTTGGAAT. Internal right primer: CAATTCTTTTTCAGATCGGGTC. Internal WT amplicon: 831 bp. Deletion size: 564 bp. Deletion left flank: CAGAATTATTTGGTAACGTTAAATTGTGCT. Deletion right flank: GTTTGTAAAGTTCACTTGAGATATGTTGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3461 C. elegans alh-5(gk3382) V/nT1[qIs51] (IV;V). Show Description
T08B1.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3382 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCACCTTTAATAACAATGGGGA. External right primer: CTCCAAGATCTCCCTCTCATGT. Internal left primer: CTTTCCCTACTCGCGCTACTT. Internal right primer: GTGTTGTTTGCCCAAGAATGT. Internal WT amplicon: 1350 bp. Deletion size: 349 bp. Deletion left flank: TTGACAATTGTAACATACTTTGGATCGAAA. Deletion right flank: ATATACCTACGCTACCGTTACAATTTCGCA. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3462 C. elegans alh-12(gk3392) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y69F12A.2. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP heterozygotes, arrested hT2 aneuploids, and possibly non-GFP gk3392 homozygotes (if not Emb; undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.External left primer: CGGATCTGTCTGGTGGACTT. External right primer: GTTTCCAGCCGATACGACAT. Internal left primer: GCAACAGCGGATATTGTTGAT. Internal right primer: CAATTTTCACGTCCATGTCCT. Internal WT amplicon: 1413 bp. Deletion size: 709 bp. Deletion left flank: TCCAGGTGGACCATCTCAACGTATTGCCTA. Deletion right flank: ATTACTGGACTTTCCGATGAAGCTAGAGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3467 C. elegans alh-8(gk3379) II. Show Description
alh-8. Homozygous viable deletion. External left primer: CGCGTGTATTTTGTGGCTTAT. External right primer: CTCGTTCCAAACGGAATGATA. Internal left primer: ATCCGAATCGTCAGAACCAC. Internal right primer: CTGTGGGAACGACATTTGTG. Internal WT amplicon: 2065 bp. Deletion size: 1196 bp. Left flanking sequence: CTTCAAAACTTCAAATAATATTCTAATTTC. Right flanking sequence: GCAATCCAAGGCCCGTGTCCTCCGTCTTAT. Insertion sequence: CTGATCTCCAT.Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3468 C. elegans sca-1&K11D9.5(gk3383) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K11D9.2, K11D9.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3383 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGATGTTCTTCCATGGTGGC. External right primer: TCATGAGCTTCGCATTTACG. Internal left primer: AAGAACCACCACATTGAGGC. Internal right primer: AAGCGCTCAAGGAATACGAA. Internal WT amplicon: 2327 bp. Deletion size: 861 bp. Deletion left flank: CTTCAGATTGTTGCTCTGGTGGAAGATCGT. Deletion right flank: GTCCAGCGATGAACATCTTTGACACAGACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3472 C. elegans C23G10.8(gk3389) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C23G10.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3389 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCATTGAATCTCCCGTGTCT. External right primer: ATACTCAGTCAACGGCCAGG. Internal left primer: TGCATTCGTTTATCCATCCA. Internal right primer: TGTTTGAACTGCTTTGCCTG. Internal WT amplicon: 1992 bp. Deletion size: 418 bp. Deletion left flank: TCAAGTTTCAGCGAATTAAAAAGCTTCTCA. Deletion right flank: GGCCATCCACTCCATGAACGTTTTATCGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3475 C. elegans eelo-2(gk3391) IV/nT1[qIs51] (IV;V). Show Description
ZK550.3. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3391 homozygotes (sterile, lays no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACCGATAAGGGACTCGAAA. External right primer: CTCATCCACCACTTGGGTCT. Internal left primer: TTTCCTGTCGGAAAATTCAGTT. Internal right primer: CGACATTTCCATTTCATCTTGA. Internal WT amplicon: 1542 bp. Deletion size: 386 bp. Deletion left flank: TCATCAGAATTTTGATAAATACTTTTAAAA. Deletion right flank: TTTAATTTTTTTTAAAGAAAAATATTCATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3477 C. elegans pygo-1(gk3390) IV/nT1[qIs51] (IV;V). Show Description
C02B10.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3390 homozygotes (sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAATCCACAGAACCG. External right primer: TTGCGGTAGCTTAGGCAGAT. Internal left primer: CCTGAGTCATCTCCTGCACA. Internal right primer: AGAGCGGGATCTGGAAAAAT. Internal WT amplicon: 2056 bp. Deletion size: 775 bp. Deletion left flank: CGGCGGAGCAAGAGTATTATTATTTCACGT. Deletion right flank: GCTGGAGATGATGGCGAATTCTTCGAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3478 C. elegans +/mT1 II; spcs-2(gk3387)/mT1[dpy-10(e128)] III. Show Description
Homozygous lethal or sterile deletion balanced by translocation marked with dpy-10(e128). Heterozygotes are fertile WT and segregate fertile WT, gk3387 homozygotes (sterile adults that tend to explode at vulva), dead eggs (aneuploids) and sterile Dpy-10 mT1 homozygotes. Pick fertile WT to maintain. Reasonably well balanced but not perfect.
VC3479 C. elegans aph-2(gk3380)I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
aph-2. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2950 homozygotes (arrest stage not determined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGAAGTGGAGATAGGTGGG. External right primer: TGTTTCAGAACAGCGACCTG. Internal left primer: ATTCCGAGTGTCGTTTTTCG. Internal right primer: CCATTTAAAGGCGCAAACAT. Internal WT amplicon: 1456 bp. Deletion size: 426 bp. Left flanking sequence: AAAGAAACATTGAATGTGAAAAGTGAAAAG. Right flanking sequence: GAGTTTCGCATTAAAGAAAACTAGATTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3498 C. elegans gei-4(gk3388)/sC1[dpy-1(s2170)] III. Show Description
W07B3.2. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and gk3388 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGGATAATCATGCCAGAAGTG. External right primer: ATCGAGCAGAATTTGTCCATTT. Internal left primer: ACACCTGAATCTGCTGCTGTT. Internal right primer: ACGAATTGAATGAAATCACGC. Internal WT amplicon: 2021 bp. Deletion size: 296 bp. Deletion left flank: ATCCAGTGCTTCTCCGTTGATACGGCCTAT. Deletion right flank: CAAGTTTGGTATGGTAAATATTTAGCAGAC. Insertion Sequence: GTTTGGTATGGTAAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC670 C. elegans gar-3(gk337) V. Show Description
Y40H4A.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC765 C. elegans lagr-1(gk331) I. Show Description
Y6B3B.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC767 C. elegans set-18(gk334) I. Show Description
T22A3.4a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC771 C. elegans dhhc-14(gk330) X. Show Description
D2021.2a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC779 C. elegans ric-4(gk333) V. Show Description
Y22F5A.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC781 C. elegans cpn-3(gk336) I. Show Description
F28H1.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC783 C. elegans tbc-12(gk332) X. Show Description
R11B5.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC784 C. elegans ola-1(gk335). Show Description
W08E3.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC815 C. elegans tbc-12(gk339) X. Show Description
R11B5.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC841 C. elegans alx-1(gk338) III. Show Description
R10E12.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807