R11B5.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

attf-5 homozygous viable deletion, detectable by nested PCR. ceh-90 homozygous viable deletion, identified by CGH. gk1279: External left primer: ctcccgaaaatccagcatta. External right primer: aactcatggaaaccgtcctg. Internal left primer: ccatagcaactgcgatgatg. Internal right primer: atgagcattagagcgcgatt. Internal WT amplicon: 2677 bp. Deletion breakpoints not determined; deletion of approximately 1030 bp narrowed to 1142-bp region between X coordinates 788497 and 789639 (WS279). Validation: gk1279 confirmed by CGH. gk3396: Left flanking probe AACAACAAACCTGAGCTTCGTTTCGATTCAATAAACCAGCAAGACGATTC; left deleted probe: ATAAACCAGCAAGACGATTCATTTCAGAAGTTCCAGGGTGTGAGTCTTTT; right deleted probe: ACAAGTTTTTCGGATGGAGAATTACCTAAAATGTCGATGAAAGATTATTG; right flanking probe: ATTGAGAGATAGAACCATAGAAAACACTAAATACGCAGATAGGTTATCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y69F12A.2. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP heterozygotes, arrested hT2 aneuploids, and possibly non-GFP gk3392 homozygotes (if not Emb; undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.External left primer: CGGATCTGTCTGGTGGACTT. External right primer: GTTTCCAGCCGATACGACAT. Internal left primer: GCAACAGCGGATATTGTTGAT. Internal right primer: CAATTTTCACGTCCATGTCCT. Internal WT amplicon: 1413 bp. Deletion size: 709 bp. Deletion left flank: TCCAGGTGGACCATCTCAACGTATTGCCTA. Deletion right flank: ATTACTGGACTTTCCGATGAAGCTAGAGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK550.3. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3391 homozygotes (sterile, lays no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACCGATAAGGGACTCGAAA. External right primer: CTCATCCACCACTTGGGTCT. Internal left primer: TTTCCTGTCGGAAAATTCAGTT. Internal right primer: CGACATTTCCATTTCATCTTGA. Internal WT amplicon: 1542 bp. Deletion size: 386 bp. Deletion left flank: TCATCAGAATTTTGATAAATACTTTTAAAA. Deletion right flank: TTTAATTTTTTTTAAAGAAAAATATTCATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C02B10.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3390 homozygotes (sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAATCCACAGAACCG. External right primer: TTGCGGTAGCTTAGGCAGAT. Internal left primer: CCTGAGTCATCTCCTGCACA. Internal right primer: AGAGCGGGATCTGGAAAAAT. Internal WT amplicon: 2056 bp. Deletion size: 775 bp. Deletion left flank: CGGCGGAGCAAGAGTATTATTATTTCACGT. Deletion right flank: GCTGGAGATGATGGCGAATTCTTCGAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807