| EAG25 |
C. elegans |
eagIs6[*fxIs10] ujIs113 II. Show Description
eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)]. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. H2::mCherry marks germline nuclei. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.
|
|
| GG25 |
C. elegans |
let-2(g25) X. Show Description
Temperature sensitive. Maintain at 15C. See also CGC 1806.
|
|
| CY398 |
C. elegans |
daf-16(mg255) I; sqt-1(sc13) age-1(mg109) II. Show Description
Sqt phenotype. The daf-16(mg255) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg255 is a nonsense mutation Try144Amb.
|
|
| DAG253 |
C. elegans |
lite-1(ce314) X; domEx253. Show Description
domEx253 [mec-4p::Chrimson::GFP + unc-122p::RFP]. Pick animals with red fluorescence in coelomocytes to maintain. Red-light optogenetic line for gentle touch receptor neurons (TRN). Transgenic animals expressing the red light-activated channelrhodopsin Chrimson into TRNs using the mec-4 promoter. In animals grown on all trans-retinal-containing medium, red light stimuli trigger behaviors similar to those evoked by gentle touch. Note that very strong blue light stimuli may also activate Chrimson. Reference: Schild LC & Glauser DA. Genetics. 2015 Aug;200(4):1029-34. doi: 10.1534/genetics.115.177956. PMID: 26022242.
|
|
| EG2537 |
C. elegans |
oxEx344. Show Description
oxEx344 [MosPolyA substrate + myo-2::GFP]. Should be grown at 25C.
|
|
| IG256 |
C. elegans |
xnp-1(tm678) I. Show Description
Temperature sensitive. Sterile at 25C. Larval lethal with lin-35 and hlp-2. The deletion extends 673 bp (and not 674 + 1 insertion as described on the S. Mitani website). The deletion breakpoint is AAAAAAAGAGCTGAAACATCGGAAGAGTCA/AGATGCAGAGAGAGCAGAGAAAGAGAGA AGA. B0041.7 Reference: Cardoso C, et al. Dev Biol. 2005 Feb 1;278(1):49-59.
|
|
| NG2501 |
C. elegans |
epi-1(gm121) kyIs5 IV. Show Description
kyIs5 [ceh-23p::unc-76::GFP + lin-15(+)] IV. kyIs5 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons.
|
|
| NG2517 |
C. elegans |
him-5(e1490) V; gmIs5. Show Description
gmIs5 [ina-1::GFP + rol-6(su1006)]. Rollers. ina-1(gm86) may still be in the background.
|
|
| NG2535 |
C. elegans |
cam-2(gm124) I. Show Description
Recessive. Small, moderate Unc. 10% Muv. CAN cell migration defects. Clr.
|
|
| OH14547 |
C. elegans |
pha-1(e2123) III; otEx6803. Show Description
otEx6803 [gab-1p::GFP + pha-1(+)]. Maintain at 25C to select for array. Reporter contains 5 kb of gab-1 promoter fused with GFP. Derived from injection of pMG250; line 1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
|
|
| SHG2534 |
C. elegans |
laf-1(ust492[laf-1::GFP::3xFlag]) III. Show Description
GFP::3xFlag inserted into endogenous laf-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.
|
|
| SHG2536 |
C. elegans |
glh-3(ust494[sxFlag::GFP::glh-3]) I. Show Description
3xFlag::GFP inserted into endogenous glh-3 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.
|
|
| SHG2537 |
C. elegans |
gld-3(ust495[gld-3::GFP::3xFlag]) II. Show Description
GFP::3xFlag inserted into endogenous gld-3 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.
|
|
| SHG2538 |
C. elegans |
deps-1(ust496[deps-1::GFP::3xFlag]) I. Show Description
GFP::3xFlag inserted into endogenous deps-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.
|
|
| SHG2540 |
C. elegans |
gld-4(ust498[gld-4::GFP::3xFlag]) I. Show Description
GFP::3xFlag inserted into endogenous gld-4 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.
|
|
| TG2519 |
C. elegans |
rip-1(tm2948) III. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Taylor MRG, et al. Cell. 2015 Jul 16;162(2):271-286.
|
|
| TG2520 |
C. elegans |
pole-4(tm4613) II. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. Genome Res. 2018 May;28(5):666-675.
|
|