| AV38 |
C. elegans |
mnDp66 (X;I); meDf2 X. Show Description
Produces 31% XO male self progeny; nondisjunction is correlated with a high frequency of achiasmate X chromosomes in oocyte nuclei, and a reduced frequency of X chromosome crossovers. meDf2 disrupts the function of the cis-acting X chromosome meiotic pairing center. meDf2/+ heterozygotes produce 4-6% XO progeny, so the presence of meDf2 can be followed in heterozygotes by this weak Him phenotype.
|
|
| CA998 |
C. elegans |
ieDf2 [unc-119+]/mIs11 IV. Show Description
mIs11 [myo-2p::GFP + pes-10p::GFP + F22B7.9::GFP]. Heterozygotes are wild-type with dim GFP signal in the pharynx. mIs11 homozygotes are wild-type with bright GFP in the pharynx. ieDf2 homozygotes (non-GFP) develop normally but produce 97.5% inviable embryos and a high frequency of males among the surviving self-progeny. Pick WT with dim GFP+ in pharynx to maintain. mIs11 homozygotes will quickly overtake the population if not selected against. GFP expression in 4-cell embryos, pharyngeal muscle and gut. ieDf2 is a deficiency of zim-1, zim-2, zim-3, and him-8 generated by MosDel, resulting in single-copy insertion of a copy of the C. briggsae unc-119 gene on Chromosome IV. The deletion spans the sequences from the beginning of the zim-1 coding sequence through the ttTi22866 Mos1 insertion site.
|
|
| CB1517 |
C. elegans |
eDf2 III; eDp6 (III;f). Show Description
DpyUnc. See also WBPaper0000498 and WBPaper00002306.
|
|
| CB4118 |
C. elegans |
unc-32(e189) ooc-4(e2078)/eDf2 III. Show Description
Heterozygotes are WT and segregate WT, Uncs which are sterile and dead eggs (eDf2 homozygotes). Strain breaks down very rarely.
|
|
| RG3221 |
C. elegans |
veDf2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP] IV. Show Description
Homozygous viable. 2996 bp deletion removes his-31, his-32, his-33 and his-34, with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAGAGCATAGACGACGTCCATAGCAGTTA ; Right flanking sequence: CCTAATTGAGTTGTTCCAATAAAATTTTCA. sgRNA #1: CGAGCACGCCAAGAGAAAGA; sgRNA #2: TCTTTCAGAACAACATCTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| CB2769 |
C. elegans |
eDf3/eDf24 I. Show Description
Heterozygotes are WT and segregate WT, dead eggs, and larval lethal (eDf24 homozygotes). eDf24 = let(e2000).
|
|
| CB2770 |
C. elegans |
eDf4/eDf24 I. Show Description
Heterozygotes are WT and segregate WT, dead eggs, and larval lethals (eDf24 homozygotes). eDf24 = let(e2000).
|
|
| CB2771 |
C. elegans |
eDf5/eDf24 I. Show Description
Hets are WT and segregate WT, dead eggs, and larval lethals (eDf24 homozygotes). eDf24 = let(e2000).
|
|
| CB2772 |
C. elegans |
eDf6/eDf24 I. Show Description
Hets are WT and segregate WT, dead eggs, and larval lethals (eDf24 homozygotes). eDf24 = let(e2000).
|
|
| CB2773 |
C. elegans |
eDf7/eDf24 I. Show Description
Hets are WT and segregate WT, dead eggs, and larval lethals (eDf24 homozygotes). eDf24 = let(e2000).
|
|
| CB2775 |
C. elegans |
eDf9/eDf24 I. Show Description
Hets are WT and segregate WT, dead eggs, and larval lethals (eDf24 homozygotes). eDf24 = let(e2000).
|
|
| CB2776 |
C. elegans |
eDf10/eDf24 I. Show Description
Hets are WT and segregate WT, dead eggs, and larval lethals (eDf24 homozygotes). eDf24 = let(e2000).
|
|
| CB2777 |
C. elegans |
eDf11/eDf24 I. Show Description
Hets are WT and segregate WT, dead eggs, and larval lethals (eDf24 homozygotes). eDf24 = let(e2000).
|
|
| CB2778 |
C. elegans |
eDf12/eDf24 I. Show Description
Hets are WT and segregate WT, dead eggs, and larval lethals (eDf24 homozygotes). eDf24 = let(e2000).
|
|
| CB2779 |
C. elegans |
let-201(e1716) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
|
|
| CB2780 |
C. elegans |
let-203(e1717) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
|
|
| CB2781 |
C. elegans |
unc-54(e1092) let-208(e1718)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
|
|
| CB2782 |
C. elegans |
let-204(e1719) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
|
|
| CB2784 |
C. elegans |
let-202(e1720) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
|
|
| CB2785 |
C. elegans |
let-206(e1721) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
|
|
| CB2786 |
C. elegans |
let-205(e1722) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
|
|
| CB2787 |
C. elegans |
let-207(e1723) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
|
|
| CB2818 |
C. elegans |
eDf13/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
|
|
| CB2819 |
C. elegans |
eDf14/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
|
|
| CB2820 |
C. elegans |
eDf15/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
|
|
| CB2821 |
C. elegans |
eDf16/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
|
|
| CB3397 |
C. elegans |
eDf20 III; eDp6 (III;f) Show Description
Wild type strain segregating more wild type and embryonic lethals, in approximately 1:1 ratio.
|
|
| CB3740 |
C. elegans |
eDf24 I; eDp20 (I;II); mnT12 (IV;X). Show Description
Phenotypically WT. See also CGC 801. eDf24 = let(e2000).
|
|
| CB4077 |
C. elegans |
eDf21/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
WT heterozygotes segregate WT, DpyUnc and unhatched eggs.
|
|
| CB927 |
C. elegans |
eDf28 IV. Show Description
Unc-weak kinker. Fairly active. Healthy. See WBPaper00002474. Previously called unc-24(e927).
|
|