Produces 31% XO male self progeny; nondisjunction is correlated with a high frequency of achiasmate X chromosomes in oocyte nuclei, and a reduced frequency of X chromosome crossovers. meDf2 disrupts the function of the cis-acting X chromosome meiotic pairing center. meDf2/+ heterozygotes produce 4-6% XO progeny, so the presence of meDf2 can be followed in heterozygotes by this weak Him phenotype.

mIs11 [myo-2p::GFP + pes-10p::GFP + F22B7.9::GFP]. Heterozygotes are wild-type with dim GFP signal in the pharynx. mIs11 homozygotes are wild-type with bright GFP in the pharynx. ieDf2 homozygotes (non-GFP) develop normally but produce 97.5% inviable embryos and a high frequency of males among the surviving self-progeny. Pick WT with dim GFP+ in pharynx to maintain. mIs11 homozygotes will quickly overtake the population if not selected against. GFP expression in 4-cell embryos, pharyngeal muscle and gut. ieDf2 is a deficiency of zim-1, zim-2, zim-3, and him-8 generated by MosDel, resulting in single-copy insertion of a copy of the C. briggsae unc-119 gene on Chromosome IV. The deletion spans the sequences from the beginning of the zim-1 coding sequence through the ttTi22866 Mos1 insertion site.

DpyUnc. See also WBPaper0000498 and WBPaper00002306.

Heterozygotes are WT and segregate WT, Uncs which are sterile and dead eggs (eDf2 homozygotes). Strain breaks down very rarely.

Homozygous viable. 2996 bp deletion removes his-31, his-32, his-33 and his-34, with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAGAGCATAGACGACGTCCATAGCAGTTA ; Right flanking sequence: CCTAATTGAGTTGTTCCAATAAAATTTTCA. sgRNA #1: CGAGCACGCCAAGAGAAAGA; sgRNA #2: TCTTTCAGAACAACATCTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Heterozygotes are WT and segregate WT, dead eggs, and larval lethal (eDf24 homozygotes). eDf24 = let(e2000).

Heterozygotes are WT and segregate WT, dead eggs, and larval lethals (eDf24 homozygotes). eDf24 = let(e2000).

Hets are WT and segregate WT, dead eggs, and larval lethals (eDf24 homozygotes). eDf24 = let(e2000).

Hets are WT and segregate WT, dead eggs, and larval lethals (eDf24 homozygotes). eDf24 = let(e2000).

Hets are WT and segregate WT, dead eggs, and larval lethals (eDf24 homozygotes). eDf24 = let(e2000).

Hets are WT and segregate WT, dead eggs, and larval lethals (eDf24 homozygotes). eDf24 = let(e2000).

Hets are WT and segregate WT, dead eggs, and larval lethals (eDf24 homozygotes). eDf24 = let(e2000).

Hets are WT and segregate WT, dead eggs, and larval lethals (eDf24 homozygotes). eDf24 = let(e2000).

Hets are WT and segregate WT, dead eggs, and larval lethals (eDf24 homozygotes). eDf24 = let(e2000).

Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).

Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).

Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).

Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).

Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).

Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).

Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).

Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).

Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).

Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).

Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).

Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).

Wild type strain segregating more wild type and embryonic lethals, in approximately 1:1 ratio.

Phenotypically WT. See also CGC 801. eDf24 = let(e2000).

WT heterozygotes segregate WT, DpyUnc and unhatched eggs.

Unc-weak kinker. Fairly active. Healthy. See WBPaper00002474. Previously called unc-24(e927).