Search Strains

More Fields
Strain Species Genotype Add
CB502 C. elegans sma-2(e502) III. Show Description
Small. Recessive. Male spicules abnormal. M-MATING-NO SUCCESS. Synthetic lethal common.
DG728 C. elegans sma-2(e502) emb-30(tn377) ced-7(n1892) unc-69(e587) III. Show Description
Temperature sensitive emb-30 allele. Maintain at 15C. Small. Unc. Cell death abnormal.
DG796 C. elegans sma-2(e502) tnDf2/sma-2(e502) ced-7(n1892) unc-69(e587) III. Show Description
Heterozygotes are SmaCed and segregate SmaCed, SmaCedUnc and dead eggs. Maintain by picking SmaCed. tnDf2 is not transmitted well by males (i.e. tnDf2/+ males have a low mating efficiency).
DG801 C. elegans unc-32(e189) tnDf2/sma-2(e502) ced-7(n1892) unc-69(e587) III. Show Description
Heterozygotes are Ced and segregate Ced, dead eggs and SmaCedUncs. Maintain by picking Ced. tnDf2 is not transmitted well by males (i.e. tnDf2/+ males have a low mating efficiency).
FK410 C. elegans sma-2(e502) III; sma-5(n678) X. Show Description
Very small. Small brood size (about 1/10 that of WT). Grows very slowly. Reference: Watanabe, N et al. Genes to Cells 2007. 12(5):603-609.
MT3022 C. elegans nDf20/sma-2(e502) unc-32(e189) III. Show Description
Heterozygotes are WT and segregate WT, SmaUnc and dead eggs. Maintain by picking WT.
MT4995 C. elegans sma-2(e502) ced-7(n1892) III. Show Description
Small. Maternal effect persistent cell corpses.
MT4996 C. elegans sma-2(e502) ced-7(n1892) unc-69(e587) III. Show Description
PJ1224 C. elegans sma-2(e502) III; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Small body size. Slow growth. Strong lacZ staining in body wall.
RG3002 C. elegans sra-1(ve502[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1018 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: caaatacaaaaaactgtatttaagatgtaa ; Right flanking sequence: taccaacatgcatgtttcaagaaatctaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
WM98 C. elegans sma-2(e502) ced-7(n1892) cdk-1(ne236)/qC1 [dpy-19(e1259) glp-1(q339) III. Show Description
Heterozygotes are WT and segregate WT, Smalls which produces dead eggs, and Dpy Steriles. Throws males.