Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CB1033 C. elegans che-2(e1033) X. Show Description
Chemotaxis abnormal. Amphid defect-EM. M-MATING-NO SUCCESS
DR170 C. elegans unc-5(e53) IV; che-2(e1033) X. Show Description
Dauer defective. Unc-coiler.
OS2723 C. elegans hsf-1(sy441) I; che-2(e1033) X; nsEx1552. Show Description
nsEx1552 [sra-6p::hsf-1 + hsp-16-2::che-2 + rol-6(su1006)]. Rollers. Pick Rollers to maintain. Reference: Bacaj T, Shaham S. Genetics. 2007 Aug;176(4):2651-5.
OS2728 C. elegans hsf-1(sy441) I; che-2(e1033) X; nsEx1555. Show Description
nsEx1555 [osm-6p::hsf-1 + hsp-16-2::che-2 + rol-6(su1006)]. Rollers. Pick Rollers to maintain. Reference: Bacaj T, Shaham S. Genetics. 2007 Aug;176(4):2651-5.
RG3533 C. elegans mrps-34(ve1033[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III.  Larval arrest. Deletion of 1120 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) arrested larvae (ve1033 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: AAACCTGAGTTTATTTACGCAAATTCGCCA; Right flanking sequence: CGGAGTTGTGAGAGAATCTCGAACAAAAAC. mrps-34 crRNA A: AGAAACGAACCAAACATCAG; mrps-34 crRNA B: CAGCAGAATAACATACGTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.