| RW3616 |
C. elegans |
deb-1(st554)/unc-5(e53) unc-24(e138) IV. Show Description
Heterozygotes are WT and segregate WT, Uncs and Pats. Maintain by picking WT and checking for correct segregation of progeny. Received new stock from Waterston lab 5/98. st554 previously called pat-8.
|
|
| RW3562 |
C. elegans |
unc-44(e362) deb-1(st555)/unc-82(e1323) unc-24(e138) IV. Show Description
Heterozygotes are WT and segregate WT, Uncs (unc-82 unc-24 homozygotes) and dead eggs (unc-44 deb-1 homozygotes).
|
|
| NK2478 |
C. elegans |
deb-1(qy48[deb-1::mNG + LoxP]) IV. Show Description
CRISPR/Cas9 insertion of mNeonGreen tag into endogenous deb-1 locus. Low penetrance Rup and Pvl. Reference: Park K, et al. eLife. 2023 Jul 5;12:RP87037. doi: 10.7554/eLife.87037. PMID: 37405383.
|
|
| RG3439 |
C. elegans |
deb-1(ve939[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Maintain by picking wild-type GFP+ mKate2+. Deletion of 7456 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead embryos (ve939 homozygotes; embryonic lethal), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Left flanking Sequence: CCATCAGAATGGCCATTCTCTTCGCAGCCG; Right flanking sequence: ttgtaagatttgtacagatttttcgagctt. deb-1 sgRNA A: ACAGGAGAACGATATTGTGG; deb-1 sgRNA B: accatccataagtctcaagg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RSL136 |
C. elegans |
deb-1(ftw88[deb-1::mCherry]) IV. Show Description
Endogenous deb-1 locus tagged with mCherry. Bright red fluorescence in all muscles is visible by dissection fluorescence microscopy. Please contact Ryan Littlefield prior to publishing work with this strain.
|
|
| RSL83 |
C. elegans |
deb-1(ftw60[deb-1::GFP]) IV. Show Description
Endogenous locus tagged with GFP using CRISPR/Cas9. Body muscles are visibly green by dissection fluorescence microscopy. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.
|
|