Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
DG4392 C. elegans cyb-3(tn1755[gfp::3xflag::cyb-3]) V. Show Description
Although this strain is maintainable as a homozygote it produces many dead embryos (~80%) and has a low viable brood size (~24 ± 18). Thus, the GFP tag compromises CYB-3 function.
VC388 C. elegans cyb-3(gk195) V/nT1 [qIs51] (IV;V). Show Description
T06E6.2, T06E6.3. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and slow-growing GFP- sterile Uncs (gk195 homozygotes). nT1[qIs51] homozygotes inviable. Pick GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
JK5742 C. elegans cyb-3(q914[cyb-3::3xMyc]) V. Show Description
Internal 3xMyc tag inserted into endogenous cyb-3 locus.
OD3737 C. elegans cyb-3(lt110) V/nT1 [qIs51] (IV;V). Show Description
CRISPR/Cas9 engineered deletion of cyb-3. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. gRNA sequences: tcaggtcgacattcttggcc & gttatgggtatgagagcatt Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
OD4087 C. elegans cyb-3(lt135[mNG::tev::loxP::3xFlag::cyb-3]) V. Show Description
mNeonGreen and Flag tags inserted at 5' end of endogenous cyb-3 locus using CRISPR/Cas9 engineering. Strain has lethality and brood size defects. gRNA sequence: tgaagtcaggtcgacattct Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
OD5149 C. elegans ltSi1668 I; unc-119(ed3) III. Show Description
ltSi1668 [cyb-3p::mNeonGreen::cyb-3(re-encoded)::cyb-3 3'UTR + Cbr-unc-119(+)] I. CYB-3::mNG reporter using its own promoter and UTR; cyb-3 was re-encoded to confer resistance to dsRNA targeting endogenous cyb-3.