| VC1751 |
C. elegans |
nhr-246(gk856) V. Show Description
ZK1037.4. External left primer: GGAAGCCGGTAATCAATGAA. External right primer: CTTCCATAGGACTCCCACGA. Internal left primer: GGGAATGTCAAAGAGTCCCA. Internal right primer: CCAAAGATCGCCATGACATA. Internal WT amplicon: 2384 bp. Deletion size: 918 bp. Deletion left flank: GAAACTAATCTGTTTGAAATTTTATAATAT. Deletion right flank: ACAACACATTTTTTAATGGGACCTCTCACA. Insertion Sequence: GTGTTTGAAATTTTATAATATATAATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1752 |
C. elegans |
Y23H5A.2&cars-1(ok2280) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y23H5A.2, Y23H5A.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2280 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTCCATGGAAAAGATCCGAA. External right primer: TGGAACGGAGGTAAAACGAC. Internal left primer: ACCCCATATCGTGTCAATGG. Internal right primer: ACGGATTCAAGATCTGGTGG. Internal WT amplicon: 2132 bp. Deletion size: 475 bp. Deletion left flank: CAACGCGACCGCCGAAGCCGCACAATTCTG. Deletion right flank: TTCTCCGGATCTCGAAGAAAAACGCCGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1754 |
C. elegans |
nhr-162(gk846) V. Show Description
C33G8.10. External left primer: TGCTTAATCCTCCGATTTGG. External right primer: TCAAACATGCTCCCAACAAA. Internal left primer: TCGCATCTTTGAACCAATCA. Internal right primer: TTGTCTTTGCCCATTTGACA. Internal WT amplicon: 2003 bp. Deletion size: 919 bp. Deletion left flank: ACGAGGTACTATGCGAGCCTAGAATATATG. Deletion right flank: TAAAGTATCAAAGTAAGTACCAAAGTACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1755 |
C. elegans |
nhr-168(gk847) V. Show Description
C50B6.8. External left primer: TTTTCCGTTTCTCGCAGAGT. External right primer: CAGGGCGTCAACCATTACTT. Internal left primer: GGTTTCAGAAGTTGCTGGGA. Internal right primer: AAAGATCCGGAAACGTGTTG. Internal WT amplicon: 2267 bp. Deletion size: 837 bp. Deletion left flank: GAATATGCTGGGCCAGTTGGTTTTTTACCA. Deletion right flank: TGCACTCGGATCTGGCAGACAGGAACACTG. Insertion Sequence: CACTCGGCACTCGCACTTTAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1756 |
C. elegans |
Y39E4B.5(gk848) III. Show Description
Y39E4B.5. External left primer: AGCAGAAACTGTGCGAACCT. External right primer: CATTCCGAGAACACACATCG. Internal left primer: TAGAGCGAATAAAGCCCGAA. Internal right primer: CTAGAGGCGACGTTTCTTGG. Internal WT amplicon: 2038 bp. Deletion size: 753 bp. Deletion left flank: GAAAATACGATTGCTCTGTTCCAGGTGGAT. Deletion right flank: GGAAGAAAGTTCGGCTACATCGTCTGCGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1757 |
C. elegans |
acc-2(ok2216) IV. Show Description
C53D6.3. External left primer: CGCTCGCCACTTCTTTTAAC. External right primer: ACGAAATCGACATCCACCTC. Internal left primer: TCTCTCACTTCCGCTGACCT. Internal right primer: TTCTTTCAACCAAACGGGTC. Internal WT amplicon: 2756 bp. Deletion size: 1749 bp. Deletion left flank: ATTCTCTTTTTAATTTGACAATCAACAATT. Deletion right flank: AATGTAAGTGTAATAGAATTTCAGAATTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1758 |
C. elegans |
nhr-287(gk1014) IV. Show Description
Y41D4B.20. External left primer: TCTCGTTGCTTCCAAGTGTG. External right primer: AGGTGGCTATTTCGCATGTC. Internal left primer: TGTTGGACGATATGGAGCTG. Internal right primer: CAGCCAATTTCCGAGGTAGA. Internal WT amplicon: 2357 bp. Deletion size: 1043 bp. Deletion left flank: TTTCTTTGTACAAAAACCATCACCAGCCTC. Deletion right flank: GAAATTTTGAACATCGAACCAACTATCCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1759 |
C. elegans |
nhr-95(gk836) V. Show Description
Y39B6A.17. External left primer: CTCAGCCACCTGGTATCCAT. External right primer: AAAATTGCAGGAGAACCGTG. Internal left primer: CAAGACGGCTCCAAATATGC. Internal right primer: CGGAGGGAGCTGTAATCAAA. Internal WT amplicon: 2224 bp. Deletion size: 1000 bp. Deletion left flank: TTTTGACTTAAAACGCTCACAATTTTTCAG. Deletion right flank: TCAAATTTTTCGCTAATTTTTAGCTCAAAA. Insertion Sequence: CTAAATTTTGTTTTCTGTATTCTATTTAGAAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC176 |
C. elegans |
exc-7(ok370) II. Show Description
F35H8.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1760 |
C. elegans |
nhr-114(gk849) V. Show Description
Y45G5AM.1. External left primer: ACCTTGGGTTCCGGAATATC. External right primer: GAACCAGTCTCTCTCGTGCC. Internal left primer: CGAGCTCGTAAATCGACACA. Internal right primer: GTGGAGAGATCGGATTGGAA. Internal WT amplicon: 2261 bp. Deletion size: 1744 bp. Deletion left flank: TCATTCTTCATGTCTCCTGTATCATAGACA. Deletion right flank: ATCTACGTAGATCAAGCCGAAATGAGAAAC. Insertion Sequence: GGGATAAAGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1761 |
C. elegans |
Y51H4A.18(gk850) IV. Show Description
Y51H4A.18. External left primer: TATCGATGGGGATCAAGAGC. External right primer: TGCCTTTTTATATCAGCGCC. Internal left primer: GTAAATGGCAAATCAAGCCC. Internal right primer: CCAGGGTTCAACCAAACATC. Internal WT amplicon: 2021 bp. Deletion size: 435 bp. Deletion left flank: CTTAAAGTATACGTCGATTCTGAAAATACACTGAAAATGAAAT. Deletion right flank: TACAGGTTGGTACTTCTACTATGAAAAAAT. Insertion Sequence: TTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1762 |
C. elegans |
nhr-113(gk852) I; F44E7.7(gk3134) V. Show Description
This strain is homozygous for a deletion (gk852) in ZK1025.9, detectable by PCR using the following primers. External left primer: ACATTGGCAAAACGACACAA. External right primer: CTTAGGTAGGCTGAGGTGCG. Internal left primer: TCCTGTCAAATTGCCTACCA. Internal right primer: CTGTCCCATTACGGCTTGAT. Internal WT amplicon: 2090 bp. Deletion size: 1150 bp. Deletion left flank: TTAAAAAAATAGAAAAAAAATAGTCAACTA. Deletion right flank: GAAAAGCCTGGAGGTCTACCGTGAACTAGG. Validation: gk852 passed by CGH. Other deletion (gk3134) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1763 |
C. elegans |
F59B2.8(ok2150) III. Show Description
F59B2.8. External left primer: TATTGCCCGTGTGTGTGTTT. External right primer: ACAAGGATGCTTTACCCGTG. Internal left primer: TTCTTCGTCTCCGCACTCTT. Internal right primer: TCTCGTCTCTCACCCGTTCT. Internal WT amplicon: 2249 bp. Deletion size: 1073 bp. Deletion left flank: CTAAAATCTTTTTGGCTTTGGCTACTCCTA. Deletion right flank: CACCAGTGGTAGTTTTGTAATAGGAAACGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1764 |
C. elegans |
F12F6.7(ok2252) IV/nT1 [qIs51] (IV;V). Show Description
F12F6.7. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2252 homozygotes (sterile Unc). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTTGCCACTTCAGGGAAAG. External right primer: AGACAAGGCTGGTCCTGCTA. Internal left primer: GGCAAACAACAAGGCAATTT. Internal right primer: GATCACGCCAAAGCAAATCT. Internal WT amplicon: 3379 bp. Deletion size: 1510 bp. Deletion left flank: TAGGGTGTTCGTTTTTCGATTTTTTTTTTA. Deletion right flank: ATTTCATTCAGAAGTCCGGGATTAAGTGGA. Insertion Sequence: TTATGCCATTTGAAAGAGCATTTTTTAAATGTTTTTCGATTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1765 |
C. elegans |
rpl-20(ok2256) IV/nT1 [qIs51] (IV;V). Show Description
E04A4.8. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2256 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTCCGTAATTTGTTCGCGTT. External right primer: GATTGCTGATAACCCGTCGT. Internal left primer: GTTCCGATTTCTTGGTGCAT. Internal right primer: GAAACATGTGCAAGAGCCATT. Internal WT amplicon: 2463 bp. Deletion size: 1213 bp. Deletion left flank: TAAGAATTAATTTACCTTATCGAAATAGTG. Deletion right flank: TTCTATTACCGTATCCTTCATACACTCGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1766 |
C. elegans |
dyf-6(gk827) X. Show Description
F46F6.4. External left primer: GACTTACCACCGGCTTGTGT. External right primer: TGGATCGAGTCAGTCTCGTG. Internal left primer: GCTTTGTCTTGGAAATGGGA. Internal right primer: TGACGGTAAGGCTACACACG. Internal WT amplicon: 1942 bp. Deletion size: 669 bp. Deletion left flank: AGTGTGTCTGCAGAGGGAAAAGTTATAAAA. Deletion right flank: GAGCCCCACATTATCGTCAATCTAAAATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1767 |
C. elegans |
T24H10.1(gk3023) ldh-1(gk3142) II; gkDf25 V. Show Description
This strain is homozygous for a deletion (gk3023) in T24H10.1, detectable by PCR using the following primers. External left primer: GCACAGAAGGGTAGCTGGAG. External right primer: TTGGCTTCTGGCGTCTACTT. Internal left primer: ATGCGATAAATGGAGATGGC. Internal right primer: ACACGCGGTTATTAAGGTCG. Internal WT amplicon: 2047 bp. Deletion size: 568 bp. Deletion left flank: ATTAATACTCTCCGTCATTCTTTACCTTTT. Deletion right flank: AAATCTGCACAACTTCTACTTTCGGCACTT. Insertion Sequence: CATCTGCACA. Validation: gk3023 passed by CGH. Other deletions (gk3142, gkDf25) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1769 |
C. elegans |
nhr-277(gk853) IV. Show Description
Y94H6A.1. External left primer: TTGTCGGAGAGAAGAGGCAT. External right primer: TCTCGTCGAAATATCCCACC. Internal left primer: CGATTCTGACCCGAAGTGTT. Internal right primer: CTTCCTTCTTCACAATCGGC. Internal WT amplicon: 2016 bp. Deletion size: 1145 bp. Deletion left flank: ATCTCTTTCCACTTTTTTCAGTTCATTATT. Deletion right flank: GTGTGTGGCAACGCTGGTGCCACGTCACAC. Insertion Sequence: GT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC177 |
C. elegans |
syx-4&ant-1.4(ok372)/mIs11 IV. Show Description
T01B11.3, T01B11.4. mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] IV. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with dim GFP signal in pharynx, and segregate WT with dim GFP, WT with brighter GFP (mIs11 homozygotes), and non-GFP sterile ok372 homozygotes. Pick dim GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1770 |
C. elegans |
Y73B6BL.1(ok2308) IV/nT1 [qIs51] (IV;V). Show Description
Y73B6BL.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2308 homozygotes (mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTCCGAGAAGAGTACGCAGC. External right primer: GCATAAAAATTCCTGCCTGC. Internal left primer: CGGAATCCGAAAATGCATAC. Internal right primer: AGCTTTCCCCCGATTGTACT. Internal WT amplicon: 3151 bp. Deletion size: 1058 bp. Deletion left flank: GAAAATAAATTGAAAAATAATTTTTCAGGG. Deletion right flank: TAACAAGTTATAGCCGCAATGAATTTTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1771 |
C. elegans |
apc-1(gk824)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
W10C6.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk824 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TATGTGGAACCGAAGGAAGG. External right primer: CAGGCGTTGTTCTTTCACAA. Internal left primer: GGTCTCAGTCACCGGAGAAG. Internal right primer: ATTCAATGACCAACACGGCT. Internal WT amplicon: 2186 bp. Deletion size: 1963 bp. Deletion left flank: TGGAAGAATGCGGAGACTACACGAAAAAAT. Deletion right flank: AAAGTTATGAATTATCGTGCATTCGAGGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807. Formerly known as mat-2.
|
|
| VC1772 |
C. elegans |
skn-1(ok2315) IV/nT1 [qIs51] (IV;V). Show Description
T19E7.2. Homozygous viable/sickly deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2315 homozygotes (viable, sickly, some eggs don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGAAACCGACGTAATGTGGA. External right primer: TTTCACCTCCCACCGTCTAC. Internal left primer: CTCAACTGGGCATCTTCACA. Internal right primer: TTTCAGCCATCTCTCCTCGT. Internal WT amplicon: 2440 bp. Deletion size: 1103 bp. Deletion left flank: TTTTTGTATGTAAATTGCCAATGCCATAAT. Deletion right flank: CTCATAGGGTCGAGAGAAAATGAGAGAGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1774 |
C. elegans |
nekl-2(gk841) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZC581.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk841 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCGCCCTCTAAATTGTCA. External right primer: GCAGATTTCGTTCCAAGCTC. Internal left primer: TCTTTGTTAGCCATTTCCGC. Internal right primer: GAACAGTCTTTCGGCGATTC. Internal WT amplicon: 1654 bp. Deletion size: 354 bp. Deletion left flank: TTCAAATGGACAATTATGAAAAAGTGCGTG. Deletion right flank: TATTGATTCTTTTATTATGGATAATCAACT. Insertion Sequence: ATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1779 |
C. elegans |
F52H3.2(ok2309) II. Show Description
F52H3.2. External left primer: GCAATGTGCAACAAAATGCT. External right primer: CGATTGAAACCCGTTTTTGT. Internal left primer: CTGCCAGATTTCTTGGTCGT. Internal right primer: ACGCTGTTGATTTTTGCCTT. Internal WT amplicon: 2254 bp. Deletion size: 1310 bp. Deletion left flank: AGATAAAGTCGAAACTCCGCACGAGAAGTT. Deletion right flank: TTTTCAATTTTGTAACCTTTTCCGATTCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1780 |
C. elegans |
vps-28(ok2278)/hIn1 [unc-101(sy241)] I. Show Description
Y87G2A.10. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2278 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAAGACGTTGTGTCTTCCCG. External right primer: CTACAAACCGAGCTGAGCCT. Internal left primer: CCTCACAATTTTGAAACTGCTC. Internal right primer: AATTTCGAGTTTTCGCTTGAA. Internal WT amplicon: 3080 bp. Deletion size: approximately 1600 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1782 |
C. elegans |
+/szT1 [lon-2(e678)] I; egl-15(ok2314)/szT1 X. Show Description
F58A3.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2314 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTTGCGCGTGTTTAGTTCTG. External right primer: CAACGCTTCTAAAGCCATCC. Internal left primer: TTTTTGCAGGGTCTTTGGTC. Internal right primer: ACAAGATGGCGTTGTGTCAA. Internal WT amplicon: 2895 bp. Deletion size: 1208 bp. Deletion left flank: GTAGTGCTCGGTCCGGCGGATACGAATTCA. Deletion right flank: TTTTAATTGCGTTTCAGGAAATCGCAGTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1783 |
C. elegans |
F49E12.6(gk835)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F49E12.6. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk835 homozygotes (arrest stage/phenotype undetermined). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGCTCTGGGAACTCTTCGAT. External right primer: GGAGTGGTCGGTGTTGAAGT. Internal left primer: TATTTGGTGACGTGGCATTG. Internal right primer: CCACGTGGTGATGACAACTC. Internal WT amplicon: 2404 bp. Deletion size: 812 bp. Deletion left flank: GGCATAGTTATGGTTTTTCTTATTCTATGT. Deletion right flank: TTTGGGATTGCTCTGTCAAAGATTTCTGAT. Insertion Sequence: TTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1784 |
C. elegans |
str-148(gk3036) II; T28F3.1(gk1230) IV. Show Description
T28F3.1, M01D1.1. The allele gk1230 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: CATGGTCAACGAAGCTGAGA. External right primer: GAGAGGCAGAACCGAAGTTG. Internal left primer: TGCGACGAGATCTTGAAGTG. Internal right primer: AAAGCACATTTGGGCAAGAC. Internal WT amplicon: 2703 bp. Deletion size: 1246 bp. Deletion left flank: TTATTCTCTTTTCCCCCAAATCCCCTATAT. Deletion right flank: GGCAAATGGATAGCACGGATCTGAAATTAA. The allele gk3036 was identified by CGH but not confirmed by PCR. Left flanking probe: CTTGTTGCCCATCTCTGATTTACAACTCGGCCCATAGCGTAATTAAAAAT. Right flanking probe: GATATCCCTTCGAGAATAATATCAAAGTTAAATGTATCTTCATGTCGTTG. Left deleted probe: CACTCCAATTTTCCACGAAAATGCTTTGGCTGCATATCATACAATATTCT. Right deleted probe: ACTACCAGTTCACGTGCAGTTTGAGTTTGTTTCATCAAACCCATTAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1785 |
C. elegans |
F08A8.1(ok2257) I. Show Description
F08A8.1. External left primer: GAAGCTTGCAGAAATCCCAG. External right primer: GGGGTTATCTCCATCACGAA. Internal left primer: CATCGCCGAACTTTCATTTT. Internal right primer: TGGATGGATGAACTGATGGA. Internal WT amplicon: 3168 bp. Deletion size: 1064 bp. Deletion left flank: GTATGCGTTGAATATTGCAACAAGATACTC. Deletion right flank: CACTGGTAGCCTACTTGGGCGCCAGAAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1787 |
C. elegans |
C17E4.6(ok2296) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C17E4.6. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2296 homozygotes (viable Unc, sickly, BMD, vulval defects). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACGACCTCTTGGACGAAAT. External right primer: CCAACCCCAACTGCCTACTA. Internal left primer: AGTGCGAGTGCGTTACACTG. Internal right primer: GGAGCCATAGTCGAGAGACG. Internal WT amplicon: 2597 bp. Deletion size: 1233 bp. Deletion left flank: GATGATATTCTAGCTAAGAACAAGAAATGG. Deletion right flank: TCAACGACGACAACTCTACCAGTCAACGTC. Insertion Sequence: C. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1788 |
C. elegans |
ast-1(ok2359)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T08H4.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2359 homozygotes (embryonic or early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATAGGCCACCAGCTTCTCAA. External right primer: CCCAACTACCAACACAGGCT. Internal left primer: GACAATAGCGAAGAGCCGTC. Internal right primer: TGTGATCAAGTATTCGGCCA. Internal WT amplicon: 2386 bp. Deletion size: 946 bp. Deletion left flank: CACAGATAATAGAGCTTTTTGGAGCAGCAC. Deletion right flank: TTCATCGTCGTCGCCGAATCATCGGCGGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1789 |
C. elegans |
nduf-2.2(ok2397) III. Show Description
T26A5.3. External left primer: CGAGCATCTTTTGATGCAGA. External right primer: TGCTGTGGTCCAAAGTTGAG. Internal left primer: CTTTCATGAGCCGAGTCACA. Internal right primer: ATTTGATCGTCGAAATCGGA. Internal WT amplicon: 2684 bp. Deletion size: 910 bp. Deletion left flank: AGTTTCAAAGAGTGGAGGAATGGGTGGCAT. Deletion right flank: ATGCTTTCGCGATCATTGCATCCTCTTCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC179 |
C. elegans |
glh-1(gk100) I. Show Description
T21G5.3. Temperature-sensitive sterile. Gives some sterile progeny at 15 degrees. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1790 |
C. elegans |
ech-4(ok2291)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
R06F6.9. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2291 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGGTGAGTTTCGTTGGAAAT. External right primer: AAATGCTGCTCAAAAGCGAT. Internal left primer: ATTTCAGGCGTTCAGGATTG. Internal right primer: AACTTTTGTTGCCCGATTTG. Internal WT amplicon: 2356 bp. Deletion size: 1254 bp. Deletion left flank: GCGCAGAAAAATCTGAAAACTCTGAAGGAA. Deletion right flank: AATATCAACTGCTTTGCTCATCAAGAACTA. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1791 |
C. elegans |
ttr-1(ok2250) III. Show Description
K03H1.6. Superficially wild type. External left primer: AATTGGCCGTCTTCAATCAG. External right primer: CCCAGGTGGTAAAATGGATG. Internal left primer: GCGGTGAGATTTTAAAACGG. Internal right primer: GGCATTACCTCGCCAATAGA. Internal WT amplicon: 3092 bp. Deletion size: 1281 bp. Deletion left flank: CAACGTCAACTCCGTGTCGACATTCCAAAA. Deletion right flank: AAAAAATCAATGTTCTTCAGTTTTTTATTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1792 |
C. elegans |
C35E7.6(ok2255) I. Show Description
C35E7.6. External left primer: AAAACGGAAACGCAGAAAAA. External right primer: CGATTTATCCGTTAGCCGAA. Internal left primer: ACAGCCCGTCTGAAAGCAT. Internal right primer: CCCTGAATGGAACCTTTTGA. Internal WT amplicon: 3224 bp. Deletion size: 1875 bp. Deletion left flank: TTGGTTCGATTTGAGTGATTTTCTTTAAAA. Deletion right flank: TAAGCTCAAGCTCATAAGTTACTTGTGAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1793 |
C. elegans |
cTe154X.1(gk3143) III; ZK185.2(gk804) IV. Show Description
This strain is homozygous for a deletion (gk804) in ZK185.2, detectable by PCR using the following primers. External left primer: AACCAAACGATGTCCCTGAC. External right primer: TCGGAAATGAAAACCCCATA. Internal left primer: TATTAGAGGCATATCGGCGG. Internal right primer: ATCACACCGGCGAGAATTAG. Internal WT amplicon: 1842 bp. Deletion size: 780 bp. Deletion left flank: ACTTGAATTTTTCCAGTAATTTTAGTTTTG. Deletion right flank: CTCTACCGGAGTTTGAAGGCACTTATTCGT. Validation: No CGH probes for gk804. Other deletion (gk3143) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1794 |
C. elegans |
mop-25.2(ok2073)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Y53C12A.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2073 homozygotes (sterile with very occasional progeny). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGATCTGAGCAAGTCGATGG. External right primer: TCTCCTCTGCGATTTTCCTC. Internal left primer: CGGAAAGGGGATGGATATTT. Internal right primer: ACCGGTTTCCCAAATTTTTC. Internal WT amplicon: 2262 bp. Deletion size: 1677 bp. Deletion left flank: TCACAAATGATAATTGTGGTTTTTTTTTGA. Deletion right flank: TTCGATAGCTTTTTCGACTTTCCGCTCACT. Insertion Sequence: TAGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1795 |
C. elegans |
nrfl-1(ok2292) IV. Show Description
C01F6.6. External left primer: AATACATCGTTTTCCACGGG. External right primer: GTTAAGGCTCATCTCGTGCC. Internal left primer: CCCAATGTTTCGTCTTTTGG. Internal right primer: AATTTTGTTTTGGAAACAGTGAA. Internal WT amplicon: 3139 bp. Deletion size: 1117 bp. Deletion left flank: GAAATGCAATAATATTCAACAATTATATAT. Deletion right flank: GTAGACGACTATTTAATATTTAAAACTCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1796 |
C. elegans |
ZK1127.5&ZK1127.12(ok2279)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
ZK1127.5, ZK1127.12. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2279 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AATATGTTGCAAAGGACCGC. External right primer: CTCAGCACCTTCCAATCCTC. Internal left primer: TGAATTCTCACAATGGAGCG. Internal right primer: AAATCTGAGCCGGTCCTGTA. Internal WT amplicon: 3074 bp. Deletion size: 1999 bp. Deletion left flank: TTTAGTTTCTATTTGAGCTCAATCCTCAAA. Deletion right flank: ATCTACGGTAACAGTGTCCGATCTACGGTA. Insertion Sequence: GGAAGTGTGAAACATCTTTAGGACAGAGTGTCATAAATGTGCTTGCAAGTATTTGAGCA CTACTGTCAAGGGCACCTCCCATGTAAATTTGTTGAAGAAGAGCATGACCGGCTTCAAT TCCAATGTCTTCTGGAAGAATTGGAACTCCTGATTCGCCCTTCGGTCTTGAAATAGCTT CTGCTTGGTAGATAACACCCTCTGTCGTTTCGGCGGTTAAGAACAGACCATATCCTGGA GAAGCGCCACCAGCATCACCTTTCCGTTGATCAACAGTAATATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1797 |
C. elegans |
sft-1(ok2277)/sC1 [dpy-1(s2170)] III. Show Description
H06I04.2. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2277 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGACAACTCCTTGCCTCACC. External right primer: ATTCCCCGCCATTTATTACC. Internal left primer: CAAACAATCCCAAATTCTCG. Internal right primer: AGCTACAGTAACCCGCGAAA. Internal WT amplicon: 3080 bp. Deletion size: 1808 bp. Deletion left flank: AAAAAAAATTTCTAAATTTATTCCCAATTT. Deletion right flank: TCAAAAAATCAGGGGTTCGTTGTGAAAAAT. Insertion Sequence: TCTTCTAAATTTATTCCCAATTTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1799 |
C. elegans |
Y53C12B(gk862) II. Show Description
Y53C12B. External left primer: CTTGGCCCTATGGACTGAAA. External right primer: TTTCTTGCCCGATCGTAATC. Internal left primer: AAAGCCTACCCAACGAATGA. Internal right primer: GTGGGTGAATAAGGTCGGTG. Internal WT amplicon: 2086 bp. Deletion size: 501 bp. Deletion left flank: TCGTGTGAGGTCTTCTATCCAATCGCGGGT. Deletion right flank: ATCGATTTTTGTGATTTTATAAAGTTTGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC180 |
C. elegans |
+/eT1 III; tnt-4(gk136)/eT1 V. Show Description
T08B1.2. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk136 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1800 |
C. elegans |
Y53C12C.1(gk851) II. Show Description
Y53C12C.1. External left primer: GCATTTGTCTTTCGCCATTT. External right primer: ATCCCTTTTCGGCTCTCATT. Internal left primer: GTGCTTCTGGCAAATTGGTT. Internal right primer: TGATGTGTTGTCGGTGTCCT. Internal WT amplicon: 2021 bp. Deletion size: 631 bp. Deletion left flank: CGGAGAAATTAACTAAATTTTTAAGATCAA. Deletion right flank: ACCCCACATTGTGTTGAATATATGGCGGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1801 |
C. elegans |
cnx-1(ok2234) III. Show Description
ZK632.6. Superficially wild type. External left primer: ACCTCACATGGTGGAAAAGC. External right primer: ACAGACGCGCTCTAGCAAAT. Internal left primer: AGTTGGCTTCACTGGCTCAT. Internal right primer: CACAATGCCCCTCATTTTCT. Internal WT amplicon: 2586 bp. Deletion size: 1412 bp. Deletion left flank: CGTCTTGCGGTTCTGGATTGCTCTGGGAAC. Deletion right flank: GTTAATTGGATTTTTATAACGGAAAATTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1803 |
C. elegans |
Y51H4A.18(gk868) IV. Show Description
Y51H4A.18. External left primer: TATCGATGGGGATCAAGAGC. External right primer: TGCCTTTTTATATCAGCGCC. Internal left primer: GTAAATGGCAAATCAAGCCC. Internal right primer: CCAGGGTTCAACCAAACATC. Internal WT amplicon: 2021 bp. Deletion size: 472 bp. Deletion left flank: AGTCATTGCACAGCTGGAACAGCAACAGAGACTAGAAAAT. Deletion right flank: ATGATTTTTTCTTGGCTTAAACGATAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1804 |
C. elegans |
dyf-6(gk863) X. Show Description
F46F6.4. External left primer: GACTTACCACCGGCTTGTGT. External right primer: TGGATCGAGTCAGTCTCGTG. Internal left primer: GCTTTGTCTTGGAAATGGGA. Internal right primer: TGACGGTAAGGCTACACACG. Internal WT amplicon: 1942 bp. Deletion size: 989 bp. Deletion left flank: TGTCCCTGGAAACCAGAAATTCAGGAGTAG. Deletion right flank: ACAAACTTTAATATCAGAAATCCATTTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1805 |
C. elegans |
nhr-103(gk864) V. Show Description
F44C8.4. External left primer: ACGCCGGGAAAATTCTACTT. External right primer: GTTGTCGAGAGTTGCGTTCA. Internal left primer: TTACAACATGTTCTGGCGGA. Internal right primer: TCCGATAGCTTATCCAACCG. Internal WT amplicon: 2071 bp. Deletion size: 981 bp. Deletion left flank: TACCTTGCCAATAAAAGTGTAAAACAACAC. Deletion right flank: AAGGTTACTAACTTTTTTGTATTTTTTTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1806 |
C. elegans |
nhr-234(gk865) II. Show Description
Y38E10A.18. External left primer: TTACATTGCCTCTGTCTGCG. External right primer: TGGTTTCGAGGAAGTTTTGG. Internal left primer: CAAGGTTCGCGTCTTGAAGT. Internal right primer: ACACCAGCAAATCATCATGC. Internal WT amplicon: 1932 bp. Deletion size: 781 bp. Deletion left flank: CACCCACCCCTGATTGAAATGTCCATTGTC. Deletion right flank: AAAAGGCACCCTCCACTTCGGATCCGTCGT. Insertion Sequence: GGGGGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1807 |
C. elegans |
nhr-118&Y47D7A.3(gk811) V. Show Description
F13A2.8, Y47D7A.3. External left primer: ACTTCATCTGAATCGCCACC. External right primer: AATGGTTTTGACACCGCTTC. Internal left primer: TTATCAGATGCTGGTCCACG. Internal right primer: TGGTTGAAAGTTGGTGTCCA. Internal WT amplicon: 2061 bp. Deletion size: 1042 bp. Deletion left flank: AGTCGATTTATTCCTGACCCAAGTGGTATA. Deletion right flank: GCATCCCTTGTTCCATCTCCAAAATTGTAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|