More Fields
Strain Species Genotype
VC176 C. elegans exc-7(ok370) II. Show Description
F35H8.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2950 C. elegans Y108F1.5(ok3700) X. Show Description
Y108F1.5. Homozygous viable deletion, detectable by nested PCR. External left primer: CACAGCTGAAACCGATGCTA. External right primer: GCCACCACTAGGGAAATTGA. Internal left primer: TCAGGGCATGATGAGAGTCA. Internal right primer: TGGATCAATTTTCAGCCACC. Internal WT amplicon: 1261 bp. Deletion size: 839 bp. Deletion left flank: TTTTTGAAAAACCTACTAATGCCCGCGACT. Deletion right flank: ACTGTAGCCCCAAAAGTACGCAAACACGGA. Insertion sequence at break: CTACCCTAAGAGTCCAGTTTTCAGGTTTCTAGTCGAATTTCGACCAGAATCGGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2953 C. elegans C46H11.3(ok3704) I. Show Description
C46H11.3. Homozygous viable deletion, detectable by nested PCR. External left primer: AATTTTACACCCCCTCCAGC. External right primer: GGAGTCTCCGATTGTCCAAA. Internal left primer: GTCCTTGTTTTTGTTGGTTTTT. Internal right primer: AGCTCAATGCCCACTCACTT. Internal WT amplicon: 1318 bp. Deletion size: 391 bp. Deletion left flank: AATTTTTGAATAAATAATAATATTTCAATA. Deletion right flank: CAGGGATCCATTGTTCGAGTGTTGTCCAAT. Insertion sequence at break: GGATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2973 C. elegans nep-1(ok3705) II. Show Description
ZK20.6. External left primer: CTTGGCTCCACACCAAACTT. External right primer: GGAGTGGGCTCAGATTCTTG. Internal left primer: ATCCAACGAAGAAGAGCTGC. Internal right primer: CAACCACTCCATTCCTGGTT. Internal WT amplicon: 1137 bp. Deletion size: 443 bp. Deletion left flank: AACTGCACCAATTCCTCCGTAGTTGAGAGC. Deletion right flank: CTGAAATTTAGTTAAAAGTTAAATAGTGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2974 C. elegans pqn-26(ok3706) I. Show Description
DY3.5. External left primer: ACCCGAGTAGTTGGTGATGG. External right primer: GCAACTTATCCGCCAACATT. Internal left primer: TGGTACAACCGATGAGCTTG. Internal right primer: GCGCTTGGCATTTCTAAAGT. Internal WT amplicon: 1109 bp. Deletion size: 528 bp. Deletion left flank: ACCACTTGTTGTTGAGATATAACTGATCCA. Deletion right flank: GCGAGTTGTTGCTGTTGGGCAATCTAAAGT. Insertion Sequence: GCCTGTTGAGCTGCGATTTGTTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3015 C. elegans T20G5.10(ok3707) III. Show Description
T20G5.10. External left primer: TTGTGAAGGAGATTGCAACG. External right primer: GGAAGCTCAGTTGAGGGTTG. Internal left primer: TCTGTTTCATTTCATGTGCGA. Internal right primer: TTATCTCCGATTGGGTCTCG. Internal WT amplicon: 1347 bp. Deletion size: 645 bp. Deletion left flank: TTCTACCTCTCTGTTTCATTTCATGTGCGA. Deletion right flank: CGAGACCCAATCGGAGATAATAGTAAAACC. Insertion Sequence: TTTTCTATTTAACAACAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3029 C. elegans ran-3(ok3709)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C26D10.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3709 homozygotes (early- to mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCGTCTTTCAATCCGAGACC. External right primer: ATTGGCGATCGAGTTTTGTC. Internal left primer: GGCAGAAACACCAACGATCT. Internal right primer: AAAAAGCCACGGAAAGTTGA. Internal WT amplicon: 1104 bp. Deletion size: 592 bp. Deletion left flank: TCCGAAGGCGTAGTATTTTCCGTCTTCTCC. Deletion right flank: CTTCCTTCCTTCTCTACACCTTCCGCGGGA. Insertion Sequence: CTTTTTTTCCTTTTTTTTCCGTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3072 C. elegans scd-2(ok3702) V. Show Description
T10H9.2. External left primer: ATCACAAACCAATTGGGGAA. External right primer: TAATCCGGCTGGAAGAAATG. Internal left primer: CCCTGCGTATGCTAATTGGT. Internal right primer: TCCGGTCTAGTGGTAATCCG. Internal WT amplicon: 1147 bp. Deletion size: 660 bp. Deletion left flank: CTGATTTTATCGTTGAACGACGCGATAATC. Deletion right flank: CTTGTACAACATTACGTTTTTGATCTTCGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807