Search Strains

C28C12.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK930.8. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01G5.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T14G10.6 . Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Splicing defect and nonsense allele identified by amplicon sequencing.

C33B4.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F41H10.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08F8.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Nonsense alleles identified by amplicon sequencing.

Homozygous viable. Nonsense alleles identified by amplicon sequencing.

Homozygous viable. Nonsense alleles and splicing defect allele identified by amplicon sequencing.

Homozygous viable. Nonsense allele identified by amplicon sequencing.

Y48G1BL.2. Superficially wild type. [NOTE: According to WormBase, gk186 is a 548 bp deletion. Left external: gtcgggttttgatgcacttt Right external: atctttccatcgtttccacg Left internal: aaattcgatttttcgcgatg Right internal: caattgacgcaatttgcact] Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

D1014.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F58E1.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Recessive lethal. Nonsense allele identified by amplicon sequencing, balanced by inversion marked with dpy-10 and myo-2 GFP. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, non-GFP gk3816 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain.

T14G12.2, T14G12.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y2C2A.1/tag-80. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Nonsense allele identified by amplicon sequencing.

Homozygous viable. Nonsense alleles identified by amplicon sequencing.

Homozygous viable. Nonsense alleles and splicing defect identified by amplicon sequencing.

Homozygous viable. Nonsense allele identified by amplicon sequencing.

Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.

F59A6.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0412.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T26A5.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07H3.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Nonsense allele identified by amplicon sequencing.

B0412.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.

Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.

W04G5.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T10B9.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Homozygous viable. Nonsense allele identified by amplicon sequencing.

Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537