Search Strains

Y48G1A.6. External left primer: GCCGACAGGATGCATAAAAT. External right primer: CCCTGCTGGTTTCATATGCT. Internal left primer: GGATTCATCGTCCGATTCTG. Internal right primer: GCCAACAGAGGAGATTCTGG. Internal WT amplicon: 1178 bp. Deletion size: 722 bp. Deletion left flank: AATCCATTAATCATTGCAAATCCGACTGGA. Deletion right flank: TTTTTTCACATTCTCCACCAGAAAAAACAT. Insertion Sequence: TTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F17C11.9. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2464 homozygotes (sterile Dpy). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCTCGCCAACAAGACTGT. External right primer: TCCGAAAAGAATCATGGAGG. Internal left primer: ATTTCAGACCCCAGCATTTG. Internal right primer: TACAGCTCATGAAGGCGAGA. Internal WT amplicon: 1152 bp. Deletion size: 357 bp. Deletion left flank: AACGTTTTTCATGGGACTGAGAGTTGGAAA. Deletion right flank: ACCAAGGCTATCCCACACTTCTGGGAGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK418.9. External left primer: AATACTTCGTCGCAGTGCCT. External right primer: ACTGCCAATTTTTCGAATGG. Internal left primer: AAACGAGATCGGCACAATTC. Internal right primer: TGGTGGCATTGGAACACTAA. Internal WT amplicon: 2302 bp. Deletion size: 966 bp. Deletion left flank: ACACTGGCTTGTGGTTGTTGCATAGGATTC. Deletion right flank: GAAGTGGCTTCGGCTGGCCAGTTGCAGTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y49E10. External left primer: ACCGCACCACATATGATTGA. External right primer: GTCGTCGTCGGAACACATAA. Internal left primer: AATGCGCGCGCTTAGTAG. Internal right primer: TCACCTGTTTTAGGCATTTTCA. Internal WT amplicon: 3186 bp. Deletion size: 1053 bp. Deletion left flank: TCGAGAGTACAAAATAAGCCTGTGGAAAAA. Deletion right flank: TCCAGATCTAAATAAAGGTTTATAACAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F39H11.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2247 homozygotes (mid- to late-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GACTTCGTCGTGAGCATTCA. External right primer: ATTCTTAACCGTGCGACACC. Internal left primer: CATCATAAAGCATGTGCGCT. Internal right primer: TGTCGCTGCTCAGAAGAAGA. Internal WT amplicon: 2222 bp. Deletion size: approximately 400 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y43C5A.6. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2218 homozygotes (sterile, lays eggs that don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTTACCTCATTCTTGGCCG. External right primer: GTTCCTATCGGTGCCTTTCA. Internal left primer: TGAATCCGTGAAAGTGTGGA. Internal right primer: AGGACTTGGCACGTGTCTCT. Internal WT amplicon: 2435 bp. Deletion size: 1634 bp. Deletion left flank: AACGAACGGCTAGTCCTCGCGTGCGTCCTC. Deletion right flank: TGATACTTTCAATTCAATTAATTGGATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y2H9A.1. Homozygous maternal effect sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2326 homozygotes (maternal effect sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGTTCTTGCGGTTTTTCGTG. External right primer: TTCCAGCTACCTTCACCCAC. Internal left primer: GGTGTCGGCTACAGGTTGAT. Internal right primer: GCCACGAAAGTTTCTGAGTG. Internal WT amplicon: 3258 bp. Deletion size: 1596 bp. Deletion left flank: TCTGAAAATGACAATTGGCAAAATATAAAA. Deletion right flank: AAATTATCATTTCGAACTTCTCCACTTTCC. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C28H8.12. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2249 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACCACTGACCCGATTTCTTG. External right primer: AACAATCGAACGTTTTTGCC. Internal left primer: AAATGTGATAGTCCACCGGC. Internal right primer: CCGGTAGAGCGCAGTAACTC. Internal WT amplicon: 1224 bp. Deletion size: 707 bp. Deletion left flank: TCAAGTTTGGTAAGCATCATATTCAAACGT. Deletion right flank: TTTTCAGGTTCACTTTTTTGAACTTGACTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C39D10.3. External left primer: ACCCAAACATGTGGGACCTA. External right primer: TTGAACATTGCGATTTCGTC. Internal left primer: TTTGTCTCGAGAGCGCATTA. Internal right primer: AAATGACAACCTGGAGTCCG. Internal WT amplicon: 2866 bp. Deletion size: 1925 bp. Deletion left flank: TTAAAATTGAAAACTTTCAGCTTTGACTTT. Deletion right flank: AATACAATTAGAATTTCAGGTTGTTTATGT. Insertion Sequence: TGTACATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T05A10.2. External left primer: GCTTGAGGAGAAGGTGTTGC. External right primer: ATTCCAATCACCCAATCCAA. Internal left primer: CGCTCTTTCTGGTCCATCAT. Internal right primer: TAAGCAAGAAACTGTCCGCC. Internal WT amplicon: 2157 bp. Deletion size: 1046 bp. Deletion left flank: AAAACTCCAATGGCAACAGTCAGAAAAATT. Deletion right flank: TTTAACAACACTTTTTTAAAGTTTAATTTT. Insertion Sequence: ACAACACTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47G6A.23. External left primer: AAGAAGCTGCTGGCCAATAA. External right primer: TGGAACTCTTCCAATTTCCG. Internal left primer: TGTTTCGGTCTAAACGAGGC. Internal right primer: TCAGTGAAGTGGCGATTGAG. Internal WT amplicon: 3251 bp. Deletion size: 1913 bp. Deletion left flank: GACTGTTGGGTTACTGTAGTGGTATTGTGG. Deletion right flank: AGTACCCTTTAAAGGTGCACGCCTTTTTTC. Insertion Sequence: GAGTAATTCTTTTTTTTTCGCGTAGCCAACAAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06E2.1. External left primer: ACATTTCCTAGCGCGTCATT. External right primer: GGTCAACTTTTCCGGTGAGA. Internal left primer: TTTAACAGCAGCAGCGGAC. Internal right primer: CTGTGACAAATGCTCACGCT. Internal WT amplicon: 3075 bp. Deletion size: 2173 bp. Deletion left flank: GCCAGTTTTCTTTCAAATGTGTATCTCTTC. Deletion right flank: CAAAAACCCTAAAACTCTAAAACGATTCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y55F3BL.2. External left primer: TTTCACCCAATTTTCAAGCC. External right primer: GCTCACGGAATCTGTGTTCA. Internal left primer: CGAAGTGAGACGTTTAGGGC. Internal right primer: ATTCAATCGAATTTCGTGCC. Internal WT amplicon: 2938 bp. Deletion size: 1401 bp. Deletion left flank: ACGGGTCATAAAGCGAAAACGCGGAGGGTT. Deletion right flank: GATACATATGATGCTTAGATGTTGAAATTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F48C1.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2213 homozygotes (sterile, lays unfertilized oocytes). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTGGGTGCAAAACAGGTTC. External right primer: GGCTTACAGCTCTTGGTGGA. Internal left primer: GACCAAATTGAAGCGCATTT. Internal right primer: GAACATTTTTCCGTCAACCG. Internal WT amplicon: 2133 bp. Deletion size: 1051 bp. Deletion left flank: TGGGATGAATTTATGTGCAACATGCTCGTA. Deletion right flank: ACATTTTTATCATTATAACGAATATTCATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47D3B.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2363 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GATGCCACTTGTTCAGGGTT. External right primer: GCATGAGAGTTACACGCGAA. Internal left primer: TGGAGACATGTACCCGTTGA. Internal right primer: ATCACACGAGCCCTCAGAAC. Internal WT amplicon: 2759 bp. Deletion size: 1315 bp. Deletion left flank: TGCTTGATAAGACCCCCCTCTACTGCAACA. Deletion right flank: CAAAATCAGAACTCAAAAGCAAAGAAGGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C27A2.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2162 homozygotes (sterile, lays eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAACCAGACCCACTGCTGAG. External right primer: GAAGCTTTGCTCCGTACGAC. Internal left primer: TTCCGTGAGGAAATGGAGAC. Internal right primer: AATTGACCTGACCTTGGCTG. Internal WT amplicon: 2756 bp. Deletion size: 1104 bp. Deletion left flank: TTGTAAGCATGCGCCTTTTTAACATAAGTC. Deletion right flank: AGTCTTTCTCTGCGTCTCCTCTTCTTGTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T02G5.13. Homozygous viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2514 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGATTGGTGCACTGGTCATT. External right primer: AATCACGATACCTTGGACGC. Internal left primer: TCGTTTCGAAATTCGTCCTC. Internal right primer: ATGCCTGGTGACGACTACCT. Internal WT amplicon: 2798 bp. Deletion size: 1179 bp. Deletion left flank: TTTAAGAACAAAAACGTACCAAATGTGCTA. Deletion right flank: ATAGAAATAAGAGATATCAAGTGTTGAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F10A3.12. External left primer: AAAAATGCTCCAAAGCATGG. External right primer: GATTTTTACGGAAAACGCCA. Internal left primer: CCCAAGCTTTTCAACTTTCG. Internal right primer: TGGGAACTTTTCCTGATTGC. Internal WT amplicon: 2833 bp. Deletion size: 1054 bp. Deletion left flank: GCATGTAAAAGCTATGGTTTGGTCCAACAG. Deletion right flank: GTTTTTCTGCTTCTACTACTTAAATGGACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11H8.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2300 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCAGCATTTCCTGTAGCACG. External right primer: CAAGATAATCAGGCGAAGGG. Internal left primer: CGGCTTCCTTTCTTGTTGAG. Internal right primer: CGGAATGCAAGCAGGATATT. Internal WT amplicon: 3243 bp. Deletion size: 826 bp. Deletion left flank: TTCAAAAATGTTCGGAATCCTTCAGATGCT. Deletion right flank: GCGGGGGTCCTCCGGTGATTGGAGGAAGAC. Insertion Sequence: TCGGAATCCTTCAGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0285.10. External left primer: ACTATTCGTTGGCAACTCGC. External right primer: TGAACCGAAGACGAGACTCC. Internal left primer: GGACTCCGTAGCTGTTCTACAAA. Internal right primer: GGCCCGGACTCAGTAAAGTC. Internal WT amplicon: 3214 bp. Deletion size: 2055 bp. Deletion left flank: ATTAACATTTTGAGCTATTGGCAAAATAAA. Deletion right flank: CTTCCAAACTAAATTTGTCGAAACAAAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y66D12A.22, Y66D12A.24. Homozygous lethal or sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2400 homozygotes (late larval arrest or sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGCTCACTTGACACTTTCG. External right primer: TGGGGAAAATCGAAAACTTG. Internal left primer: CTGTGCAATTTGTGATTGCC. Internal right primer: ATATGTACCGCCGAATGACC. Internal WT amplicon: 2686 bp. Deletion size: 1690 bp. Deletion left flank: TTCATTTTGGCTAATTTCTCAGTAAAAATT. Deletion right flank: TTCGATTTAAAAAAAATCGATTTTTTTCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T20H4.2. External left primer: AGATGGGAGCCAAGACGTTA. External right primer: GACGTTGCCTTCGACATCTT. Internal left primer: TCATGCACATACAATGCCAA. Internal right primer: CTACCAAGTCACGCCCACTT. Internal WT amplicon: 2220 bp. Deletion size: 1394 bp. Deletion left flank: GGGGAATGATGGAAAGAACATTTACACTTT. Deletion right flank: ATGGGGTTAGTAATTCACCATTCGAATCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18G5.4. External left primer: TATTCCATGATGGCGTCGTA. External right primer: CATGGTTGAGTGCAATGGTC. Internal left primer: TCAGGATCTGATGAATCCCC. Internal right primer: GCAGCGCTATCCGAGAATAC. Internal WT amplicon: 2935 bp. Deletion size: 2383 bp. Deletion left flank: ACTTGTAAAAATATGAAACGTATTTCAAAA. Deletion right flank: GCTATTTTTTAATCAGTCGCCTTCATTACA. Insertion Sequence: GGTGGTACTGACCAGAATTGCAGATCTACCAACGAGGCTATACGAATTGCAGGATTTGA TAACTTTGCTGATCAGCTCCAAGAATCCAATGGCGTTTTCGAAGCATGCCCAGAGGCCC ATTCAGAACAAGGAAATGAGAGTGAAGATTTTAAAGATTTGATCAATAGTGAAACTGAG TGCAACATTGAAGACGTTGTTCTCCCGACAGTACACGTTTCTACGGATTCTGAAGAAAT CATTTCGGGCGATGTGATTATGAATGGTTAGTAGATTGTTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F49E11.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2235 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGAGCCGCTCAACACAGTT. External right primer: CGTCGGGCAATAGTAGAGGA. Internal left primer: CGTACAAACATATTGCCCCC. Internal right primer: ACTCACACAAACTGGGGAGG. Internal WT amplicon: 3315 bp. Deletion size: 2275 bp. Deletion left flank: TAGTAATTTTTTTAAGCCAAAAGCTCCTTC. Deletion right flank: TCAAGACCGGATACAGTAATTTTGACGCAA. Insertion Sequence: AGCTCCTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23B2.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2505 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGTGTCCCGTTTTGGATGT. External right primer: AGCGTCCGAATCTGAAGAAA. Internal left primer: CGGTACTTGCAAAGAAGGCT. Internal right primer: CTGCAGATCGTTTTCCGAAT. Internal WT amplicon: 1194 bp. Deletion size: 475 bp. Deletion left flank: GTATACTATTCATTTAAAAAATATTGCCTA. Deletion right flank: TTTCTGATAAAAAAGAGCACAACTTGGTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK112.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2555 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCGCCAATATGGGACTCTC. External right primer: GGATGATACGGCTTTGTGCT. Internal left primer: AGCCATTCCTGTTCCAAATG. Internal right primer: GATTGGACTTCCTCCGTGAA. Internal WT amplicon: 3295 bp. Deletion size: 1644 bp. Deletion left flank: AACAAATGCTCAAAATGGAGCAATTGATTG. Deletion right flank: TTCTCTCGTAGATTGATGTCCTTCGCGTCG. Insertion Sequence: AATTCTCAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C47G2.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2557 homozygotes (mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAATCCGTCTGACTCCTCGT. External right primer: GCTGAAAATGAGGTTTGGGA. Internal left primer: GTTGCAAACCTGGGTGGTAG. Internal right primer: GTACTCCTCCCGGACAATGA. Internal WT amplicon: 2124 bp. Deletion size: 1307 bp. Deletion left flank: TTAGGGTTAGCTGGAAAATTTTTTGATTAA. Deletion right flank: CCGTTTTTGGGATCAATTGGTCTGCTATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06G3.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2519 homozygotes (sterile, lays eggs that don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTTAAACTAGCGATGCCCG. External right primer: GAATTCCGTCCGAACCTTTT. Internal left primer: TCTTCAATCATTCACCGCTTT. Internal right primer: CGTCAACCTCTTGGCGTAGT. Internal WT amplicon: 1183 bp. Deletion size: 556 bp. Deletion left flank: TATGAGCTCCATCATATCTTTGATAGCTCT. Deletion right flank: GTCAAGGAAAGGTCATCTATCCTGAACCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T01C3.7. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2527 homozygotes (early- to mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTTCCGACGAGGAGAAGTG. External right primer: GCTTCCTCGTTATTTGCAGC. Internal left primer: AAGGTCTGAACCGATTGCAC. Internal right primer: TGCTACATATGCCGATTCCA. Internal WT amplicon: 2241 bp. Deletion size: 1271 bp. Deletion left flank: GGCAAGGTTGAGAACCAAGTAAAGATAAAA. Deletion right flank: AAAAATCCTGAAATTCAGTTTACCTCCGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0511.8. Homozygous lethal or sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2469 homozygotes (late larval arrest or sterile adult, Unc, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCAAATGCCTATCGAGACC. External right primer: CCCGAATCTCCTAATGCTCA. Internal left primer: AGCATTTTTCTGCGTCCCTA. Internal right primer: ACACGCCCTGCTACTGATCT. Internal WT amplicon: 2582 bp. Deletion size: 1317 bp. Deletion left flank: GAACACTCAAATATTGTCCATTTTTATCAC. Deletion right flank: GTGTGTCTTCATCAGAAAAGTTGATTCCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K03D10.3. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2429 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACTGTTTGAACTCACCCCG. External right primer: AAATTTCCGGTTTTCTGGCT. Internal left primer: TAAAAATTGGGTGAGGCTCG. Internal right primer: TACGGGAAAAACTGCCAAAA. Internal WT amplicon: 3157 bp. Deletion size: 2168 bp. Deletion left flank: AACTGTAATTTACGGTGTTTTATATCGAAT. Deletion right flank: GCATTTAAATCGATTTTTCCCATAAAATCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07A5.6, T07A5.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2448 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACGTGTAACCACTTCTCGCC. External right primer: CTTCATCGATCGGCTTTTGT. Internal left primer: CGGCTGTGAACTCATGACATA. Internal right primer: ATTCAAAGCTCGAGCCAAAA. Internal WT amplicon: 2903 bp. Deletion size: 1464 bp. Deletion left flank: GAGCATGAGCATCGCGATTCCAAGAATGTT. Deletion right flank: ATATTTAGTGTAGTAAAACTGTTACGAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C47A4.2. External left primer: GGGCCAAACTTTCAACAAAA. External right primer: CGAATTACGCAGGGAACAAT. Internal left primer: TAGCTCCGATGAGCACAATG. Internal right primer: GGACCAGGCTGCAAAAATAA. Internal WT amplicon: 3359 bp. Deletion size: 1566 bp. Deletion left flank: AGAACATACCTTTTGAGTATCCGAGAAATT. Deletion right flank: TTTCTCTGTGCACAAATTTGTTTTAAGTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK863.3. External left primer: TCCTTACCAACGGTCGAAAC. External right primer: CACTGGTCATCTTGAAAGCG. Internal left primer: TTGAAATTTCCGGCTAATCG. Internal right primer: ACTTGAATCGGCTGAAATGC. Internal WT amplicon: 2431 bp. Deletion size: 1504 bp. Deletion left flank: CGGTAGTACTCTCGAGTTCCAACGCCCGAG. Deletion right flank: GACGGAACTCCAGCGATAATGTCAACGAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

D1022.7. External left primer: GCCTTTTGGAAGATGGTCAA. External right primer: CCGATGAAGGAAATCCAGAA. Internal left primer: TTAATGGGATGCGGAAAGAG. Internal right primer: GCAGAATTACGGATGGAGGA. Internal WT amplicon: 3291 bp. Deletion size: 1311 bp. Deletion left flank: ACAAAAATATCAATGTTACTTACCATTGAA. Deletion right flank: AAAAATTTGTACAGTGCAATTCAAATTTTT. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F38H4.10. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2146 homozygotes (grotty, mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTCACCACTTCCCGTCTTC. External right primer: CGCATTTTCAGAATTTGGTG. Internal left primer: CAAAATGCGAATGGACAACA. Internal right primer: GGGAATCACAGAATTGGGAA. Internal WT amplicon: 2120 bp. Deletion size: 934 bp. Deletion left flank: ATTCTTTGAATGACTACTGTAGCGCCTGTG. Deletion right flank: GAAGAAACTGAACCATTACGGGAAATCATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T08G11.5. External left primer: GCGTTACAGAAGTCTGCCCT. External right primer: TGACGTCTCCAGTCCCTCTT. Internal left primer: TGTTATTTGATTCACCCGCA. Internal right primer: TTGACGGGCGGTTAATATGT. Internal WT amplicon: 3194 bp. Deletion size: 1480 bp. Deletion left flank: CGATGAGTTCTTGGTCCTCGGAAATATACA. Deletion right flank: AACATTTGTATGCATAACTTGATCTTTCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H08M01.1. External left primer: GCCTAGGATTCAGGTGGGAT. External right primer: TCATTGTGTGAACGAACGGT. Internal left primer: TGTTTCATGGGTTGGGAAAT. Internal right primer: TGATTGGGCATTCGAAAAAT. Internal WT amplicon: 3201 bp. Deletion size: 1630 bp. Deletion left flank: AAACTTTTTCGCAGCAATGACTTTTGGGGC. Deletion right flank: TCTGTGTTGGTGGATTTGGTCGCGCATCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C02F5.4, C02F5.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2511 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAGCGGTACTTGTGG. External right primer: CTTTCCTGCATCAAGCATCA. Internal left primer: TTTCTTCAATTGGAGGACATCT. Internal right primer: ATTCCAGGAAGATCGAGCAA. Internal WT amplicon: 2526 bp. Deletion size: 1604 bp. Deletion left flank: AATACTGGCTTACAAAATTTGAATCTTCTC. Deletion right flank: GAAGATCGAATCAAGGCAGATTTGTTAGAG. Insertion Sequence: GAATCAAGGCAGATTTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K04G7.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2533 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAACCCAAACGTGGCAATA. External right primer: TTGTTAAGACCATCATGCCG. Internal left primer: AAAAGTGTGCGTGGGGTAAT. Internal right primer: GTTCCATGAGCAAATTGGGA. Internal WT amplicon: 3154 bp. Deletion size: 1369 bp. Deletion left flank: TATGTCTTTCAGTATATCAAAATTAAAAAT. Deletion right flank: ATGAACAACTCCTCTGACTTGATTTGAGAG. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02B7.3. External left primer: GCTAATCAGCGGAAAAGCAC. External right primer: TTAATGCCAACAAACCGTGA. Internal left primer: GATTTTCTATCGCTCTGCCG. Internal right primer: GAAATTTCCAGAAATGCCCA. Internal WT amplicon: 2157 bp. Deletion size: 1347 bp. Deletion left flank: GCGACTGTTTTCCAAAGTGCTCCTCTGTCG. Deletion right flank: TTTTGTGGAGAGTCTGAAAATTTTAAAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04H5.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2475 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTGCCTACGTGGCAAGTACA. External right primer: AAAATGACTCACGAAACGGG. Internal left primer: TGCACGTGGCAAGGTATCTA. Internal right primer: TGCAAAAATGTTGGAGAGCA. Internal WT amplicon: 3309 bp. Deletion size: 1504 bp. Deletion left flank: TTGCAAATTCGGCAGAAGTTGCAGTGTATG. Deletion right flank: TTCAAAATGAACTTCCATACACTTACCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54D11.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2419 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCCGAAATGAGACACCAC. External right primer: CCCACCCTCGATTTACAGTC. Internal left primer: GTTTTCGGTCGGTAGAGCAC. Internal right primer: TTTGAAATCGATCGAAAAATTG. Internal WT amplicon: 3161 bp. Deletion size: 2665 bp. Deletion left flank: TAGTTTTTCAATAAATAAATACACTTTTTT. Deletion right flank: GTTGGCAATCGCTTTGGAACGACTTCACGA. Insertion Sequence: AATCCTGAGCAAAAAAGTTAAGTAGTTGAAAAAAAGTTAAGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H12C20.2. External left primer: ATTCGGCTCGATCAGGTAAA. External right primer: TGAAAGAAAACGTGTGCGAG. Internal left primer: GGTTGATCTAGCTTCGCCAG. Internal right primer: GAACATGTCGAATGAGGCAA. Internal WT amplicon: 2942 bp. Deletion size: 2158 bp. Deletion left flank: CATCTGATTAGGATATTGTGATACCACTGC. Deletion right flank: TAGCAGCAGATTGACGGCAAATGATATTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F56D6.15, F56D6.1. External left primer: GTCTCGATTTGGTAGCAGGC. External right primer: AGACTGTGTGCCACCTGATG. Internal left primer: TGCACTCCAAGGATAGTCCC. Internal right primer: GGGCTGCTGTAGAAGGTCTG. Internal WT amplicon: 3106 bp. Deletion size: 2663 bp. Deletion left flank: TTTCAAACATCGTCTCAAAAGTCCGCAAGT. Deletion right flank: TTTTCTCAACTGATTTTGCATGGTTAAGTG. Insertion Sequence: TTCTCAACTGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R107.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2215 homozygotes (sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCTTTTCTCGCAGCTCCA. External right primer: CATACATTTGCGTGTGTCCC. Internal left primer: GGGCTGTCATTCCGTTTCTA. Internal right primer: AAACCTGGGAACACATCGAC. Internal WT amplicon: 3327 bp. Deletion size: 1227 bp. Deletion left flank: ATTAATTCTGTTGGTGTGGTTTGGTTTTAT. Deletion right flank: GATTTCTAGAAAACAAACTGGTTGCTTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26G5.9. External left primer: TATCTCTTCCCAATCGGCAC. External right primer: CGAGTTCATGCTCAGCACAT. Internal left primer: TGTTTGCGAGAGAACCTTGA. Internal right primer: GTCTACTCGGAAGCTGGTGG. Internal WT amplicon: 1314 bp. Deletion size: 339 bp. Deletion left flank: GTTCATGTTCGGTTGCTGCATTCGTTGATG. Deletion right flank: ATGATTGAGCGCGCCTCGTAAATTTCTGGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0285.6. External left primer: TGAGCTCCAGAATTCCAGGT. External right primer: CCTTATCCATTTTCGGCTCA. Internal left primer: TGAGCTCGCAGATGAGAGAA. Internal right primer: TCTTTGAGCCACGTCACAAC. Internal WT amplicon: 3197 bp. Deletion size: 1459 bp. Deletion left flank: GCTGTGCATTGATGGCTCCGATTGCCTATG. Deletion right flank: GACCATCATTCTCATTTATGCTTCCGATGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26H9.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2510 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAAACATCCCATCCCGAATA. External right primer: CCATTTCACGAATTTCGGTC. Internal left primer: GTGACCCTTCGAAAAGTGGA. Internal right primer: TTTCAGTTTTTGGCACGTTTT. Internal WT amplicon: 1143 bp. Deletion size: 783 bp. Deletion left flank: CAAGTGGAGGTCATCCTCGATTTTGGCCGA. Deletion right flank: CAAAATTCTAAAAAATCGGCACTTGGAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C02F5.4, C02F5.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2516 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAGCGGTACTTGTGG. External right primer: CTTTCCTGCATCAAGCATCA. Internal left primer: TTTCTTCAATTGGAGGACATCT. Internal right primer: ATTCCAGGAAGATCGAGCAA. Internal WT amplicon: 2526 bp. Deletion size: 1268 bp. Deletion left flank: GTGGTGAGGATGATGTTATCATTCCTGAAT. Deletion right flank: CGTTGAAGAAGCGAAAAAGAATGCACAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807