Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC2118 C. elegans asd-1(ok2299) III. Show Description
R74.5. External left primer: TGGATTGTGAAAACCCCCTA. External right primer: GATGCAGAGCCTGTGAGTGA. Internal left primer: TGCGCCCCCATAATAAATAA. Internal right primer: GCAGCGACTTGATTTTGTGA. Internal WT amplicon: 3250 bp. Deletion size: 1611 bp. Deletion left flank: TCTTTCAATCTTTCATTTCTAACCGATTTC. Deletion right flank: TCAGGTAAGGAAAATAGTGTTTCGTGATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2119 C. elegans K07A1.13(ok2573) III. Show Description
K07A1.13. External left primer: TTACGCGATGCGATTCAATA. External right primer: GACGACGGGCATCTGTAAAT. Internal left primer: CCAATTATTCCAATAAATACGAAAC. Internal right primer: GTGGTTTCATTCTCGTATCTCAG. Internal WT amplicon: 1198 bp. Deletion size: 516 bp. Deletion left flank: TCTCGTATCTTGCCATGTAGATGTAATGCA. Deletion right flank: AAAGTTTTGAGTTATTTCATATCGAGCGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2120 C. elegans W03G9.5(ok2325) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
W03G9.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2325 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGTCTGCACATTTTTCTCG. External right primer: CCGTGAAATTCCCAGTGAAC. Internal left primer: GAAACTTGGAAAACCGCAAA. Internal right primer: GGATTTGCCGAAGATTCAAA. Internal WT amplicon: 2805 bp. Deletion size: 790 bp. Deletion left flank: ATTATTAATATTGAGCTCCCCCATGCCTGC. Deletion right flank: TTCCATTATTCCCGTCCTGAAAAAAAATGA. Insertion Sequence: TCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2122 C. elegans grl-23(ok2849) V. Show Description
E02A10.2. External left primer: TCGACCTTCTCGCTCTTTTC. External right primer: GAGGAGGAGGTGGAGGATGT. Internal left primer: CGACCTCATCTTCCTTCTTTTC. Internal right primer: CGCCAGTTAAGATGGTTTGG. Internal WT amplicon: 1228 bp. Deletion size: 583 bp. Deletion left flank: CTTGCGTCCACATCCACCACCGCATCCTCC. Deletion right flank: ACCTCCTCCTCCACCTGTAAATCAAATAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2123 C. elegans sri-14(ok2865) I. Show Description
M01G12.1. External left primer: CTGCTGCGTTTTTCGTATCA. External right primer: AAGAGCGAATGGATTTGGTG. Internal left primer: TCAGTCTGATCATTTTTCCTTCAA. Internal right primer: TGATTGGTCGGTCATTCAAA. Internal WT amplicon: 1166 bp. Deletion size: 532 bp. Deletion left flank: ACGTCGATTGCTTTTTGACTTCGCAGAAAT. Deletion right flank: ACAAAGTGGCACAACTATAAAAACGCCAGGAAGCACTATTTGCATGACTAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2125 C. elegans tfg-1(ok2290)/hIn1 [unc-101(sy241)] I. Show Description
Y63D3A.5. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2290 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGCTCCGGATAAACTTGGGT. External right primer: TATTCCCTTCCCACCAATCA. Internal left primer: TTCCAGATGGTGCATTCAAA. Internal right primer: AGACAGGAGCCCGAGATTTT. Internal WT amplicon: 2440 bp. Deletion size: 1264 bp. Deletion left flank: AGCAGATTAAGGTAAGGAGGATTTTGAGCG. Deletion right flank: CCACCACCGCAGGGAGCTCCCCAGCAAGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2127 C. elegans mog-4(ok2708)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
C04H5.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2708 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATCTTCGCCTGCAAATCAC. External right primer: TTCATGCCGTACCTGTTCAA. Internal left primer: TCTTCGATCCCAGTGCTTTC. Internal right primer: AAGGAGCAAAACTTCGATGG. Internal WT amplicon: 3202 bp. Deletion size: 2453 bp. Deletion left flank: ATACCAAAATATCGCCGGGAAGTGGCTGGG. Deletion right flank: GCGAATAAAAGTCGAAAAAAAAATGTTTTG. Insertion Sequence: ATTTTTTTTCGTTTTTTTTTGGGTTTATTCGAAGTATTGATTAAAATTTAAGAGCGATC GATTTTTTTCTTAATTAAAAACAAAAATCCTGAATGTTTGGTTTTTTTGCTGTTTTTGT AAATGTTCTAAAAATTACCTATAACTAGCCAAATCGGGTTCGTTGAGAAACTCTCTGAG CAGCATTCCGTCTGTCATGTATTTGAGGACAGTCTTCTCCGATGTGCAATCCTCGAAAC GAATACTGTAGCCGACCTGGAAAATGGAAGCGTTTCGAAAGAAAAATCGGAATCTGTTT TCCTCGTTTTTTTACAAGTTTAAAAATTTTTAGAAGCGGCAAAGAATTGCCCAAATTTT TTTAACTTCCAGTTTTTTTTTCTAAATTTTGGAATTTTCCGACTAGAATGAAACTTAGT TTATTTTCGCCAATTTCCAAAAACCACCCAACCTGAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2128 C. elegans Y38H8A.4(ok2793) IV. Show Description
Y38H8A.4. External left primer: CACTTCCCCCAGTTTTTGAA. External right primer: GATCAACATCACTCCGACCC. Internal left primer: CCACCTTTAAAATTGGGCAG. Internal right primer: GTGAAAAAGATGACTACATCAAGAA. Internal WT amplicon: 1314 bp. Deletion size: 551 bp. Deletion left flank: CCCCTTCTTATCCATGATGTCTCTTGCTAT. Deletion right flank: GCACAATGTTATATGATTGGAGATGCTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2129 C. elegans T19B4.1(ok2681) I. Show Description
T19B4.1. External left primer: GGCATGTAGGCAGACAGTCA. External right primer: CAAACCTTGCATCCCAAACT. Internal left primer: CAGTTGCATTTGAACCGATG. Internal right primer: TTCCAGCTCTTTGGAAAACG. Internal WT amplicon: 1163 bp. Deletion size: 519 bp. Deletion left flank: CAAGATGGAATAAAATATTTTGTGCTCCAA. Deletion right flank: AAATCTAAAATAGTCAATTTTAAGAAAAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2130 C. elegans Y65B4BR.8(ok2828) I. Show Description
Y65B4BR.8. External left primer: TAAAGGCGCACACATTTTCA. External right primer: GTTTTTGCAGCAGCCTTTTC. Internal left primer: AAAATTTGTCGTGCCGAGAT. Internal right primer: TTACAGAATGGTGGGTTTGAA. Internal WT amplicon: 1278 bp. Deletion size: 465 bp. Deletion left flank: AATCGTTCCAATTGTTTCCAGGTAATGGCT. Deletion right flank: TCGCACGATGCCTTGTCTCCACACTTACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2135 C. elegans lelo-2(ok2740)/sC1 [dpy-1(s2170)] III. Show Description
Y82E9BR.16. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2740 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAAACCTGGGGATTTTAGCG. External right primer: TATCACCACATTTCCCGTCA. Internal left primer: AATTTGAAAATTTTTGAGGTTTCAT. Internal right primer: TTTCGCGGAAATATTGAACTTT. Internal WT amplicon: 3097 bp. Deletion size: 1978 bp. Deletion left flank: TTTTTTCAAATCGTTGCTAAATTTGAATTT. Deletion right flank: GGGCTTTTTCAGCAATTTCCGGGTAATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2138 C. elegans kcnl-2(ok2818) I. Show Description
F08A10.1. External left primer: TTTCACAACTACCGCCCTTC. External right primer: AAAAAGAAGCGAACGAACGA. Internal left primer: GATGATTGGATGGTTGCCTT. Internal right primer: CCGACGTGATGATTACGCTA. Internal WT amplicon: 1193 bp. Deletion size: 546 bp. Deletion left flank: CTTCCAATCGAGTTCATAGCTCCATTTATG. Deletion right flank: AATTTCATGCAAGACACTCAACTTACTAAG. Insertion Sequence: TTTTCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2139 C. elegans C09F5.1(ok2863) III. Show Description
C09F5.1. External left primer: GTGGAGCAAATCGAGGTCAT. External right primer: CCACACAAGAATGTGTTGGC. Internal left primer: GCATCGAATAATTGAAGAGGG. Internal right primer: CCACGTCTTCTCTAGTGGGC. Internal WT amplicon: 1262 bp. Deletion size: 403 bp. Deletion left flank: TTTACTTTTCGGCACGTGGCGTCAGAGTGT. Deletion right flank: ATGATATTCACGAAGTGCGCACTGATGGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2140 C. elegans ift-74(ok2866) II. Show Description
C18H9.8. External left primer: GATGCCTGTGTCAAGAGCTG. External right primer: CCACTTCAACCTTGCCAACT. Internal left primer: GGACCTCCAAGAGCACCTACT. Internal right primer: ACGCACAATTCCATGAAGAA. Internal WT amplicon: 1310 bp. Deletion size: 488 bp. Deletion left flank: ACATTTTCCAGACTCCCGTCAAGTATTTGA. Deletion right flank: AGCTTTTAAGAGAAAGAGTTGTAGAAATGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2141 C. elegans C27B7.7(ok2868) IV. Show Description
C27B7.7. External left primer: CATGACGTCGGTTACACTGG. External right primer: CTCCGGGTCCTGAAACATTA. Internal left primer: GCCAAATCTGTTTGAAGAACTG. Internal right primer: GCATGGATTCGTGTCTTCCT. Internal WT amplicon: 1144 bp. Deletion size: 409 bp. Deletion left flank: CTCTTTTCTAAAATAAAATATTGGTGTTCA. Deletion right flank: TGGAATATTTTGAAGTTCTCTCTTATAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2142 C. elegans gpd-3(ok2870) X. Show Description
K10B3.7. External left primer: ATGACGGACAATCACAACGA. External right primer: GAAACTGCTTCAACGCATCA. Internal left primer: GGCCTTGGTAGCAATGTAGG. Internal right primer: GACCAAGCCAAGTGTCGG. Internal WT amplicon: 1117 bp. Deletion size: 851 bp. Deletion left flank: TGACAAAGTGTGGGTTGAGTGAGATGGATG. Deletion right flank: TGAGTGGAATCGTACTGGAACAAGTAGACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2143 C. elegans F54D5.3(ok2891) II. Show Description
F54D5.3. External left primer: TTGGCTTTGCAGGAGCTAAT. External right primer: CAAAATGCAGCGAAAAACAA. Internal left primer: CACCGATGACACTGGTCACT. Internal right primer: CAATTTGGCCGGAGATTTTA. Internal WT amplicon: 1165 bp. Deletion size: 455 bp. Deletion left flank: CTATTTAATAAGCTTCGTTACCAACTTCTG. Deletion right flank: CAAGGTTCGAATTGGATTTTTTTTAACTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2148 C. elegans F23B12.4(ok2848) V/nT1 [qIs51] (IV;V). Show Description
F23B12.4. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2848 homozygotes (Dpy hermaphrodite, strongly Him, males more WT. Healthy gravid WT non-GFP segregants are recombinants and not true homozygotes). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCCGCATTTGAAAGTATGA. External right primer: AAGCAAAAAGCAATGCAGGT. Internal left primer: GCAGTTGAACATCAGGGAGG. Internal right primer: GGACGCCTACGCACAATACT. Internal WT amplicon: 1145 bp. Deletion size: 396 bp. Deletion left flank: TACTACTTGAAAATGCTTCGTTAAAAATGA. Deletion right flank: GGAACTTCTAACAACAATTATATTCGACTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2149 C. elegans T12G3.1(ok2869) IV. Show Description
T12G3.1. External left primer: AGGAAGAGTGTGCGCCTTTA. External right primer: AATTCAGCAGAGCTGGCTTC. Internal left primer: TGTCAACGGACCAATCTTTG. Internal right primer: CTTCTTGTTCAAGACGGGCT. Internal WT amplicon: 1199 bp. Deletion size: 406 bp. Deletion left flank: CCACTCCAGTTCCATTCCCTCCATCTCCAA. Deletion right flank: GAAATCTGCCGAGAGACTATTCACAATGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2150 C. elegans C06B8.7(ok2814) V/nT1 [qIs51] (IV;V). Show Description
C06B8.7. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2814 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCACAGAGCGATGGTACTCG. External right primer: CCACCTCGAACCGTTTTCTA. Internal left primer: TGCAGATTCAAACCCATCAA. Internal right primer: TCCAACATTCCTTGCGTGTA. Internal WT amplicon: 1163 bp. Deletion size: 680 bp. Deletion left flank: GCTTAAAGCAGGAGAGACCAAAGCGTGCTT. Deletion right flank: TCTCCGAATGATCGTATCACACTGGCCAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2151 C. elegans E02H1.5&E02H1.6(ok2819)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
E02H1.5, E02H1.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2819 homozygotes (late larval arrest or sterile with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAGACGTCGGTTTATGCAGC. External right primer: CCATGGTGTGCTCATTTTTG. Internal left primer: CCGGCATTCAAGTCAAATCT. Internal right primer: GGCAAGTTCGCAGATTCTTT. Internal WT amplicon: 2609 bp. Deletion size: 1622 bp. Deletion left flank: ACAATAATTAACCAAATTCCAGACGATAAT. Deletion right flank: CATTTCAGATCGTTTGGACAGTGATGAAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2153 C. elegans T235F11.1(ok2186) III. Show Description
T23F11.1. External left primer: GAGACCCACTCGCTAACCAC. External right primer: GCGGGATGAACAATAGAGGA. Internal left primer: CTTCTGTCTCTCGGAAACGC. Internal right primer: CGAAAGGTATTTCAACCGGA. Internal WT amplicon: 3253 bp. Deletion size: 1421 bp. Deletion left flank: GAAAGTTATCAGAGCAAAAATGTGATAAAA. Deletion right flank: CTGACAAGCTGACACCGGATCACGAGTTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2161 C. elegans dyf-11(ok2926) X. Show Description
C02H7.1. External left primer: TTCAAGGAATGGTACCGGAG. External right primer: GGGCATTTCCAAGTTTTTCA. Internal left primer: GGAAACGCATGAAGAGAAGG. Internal right primer: CCTTGCTAGCGGATAAGCAG. Internal WT amplicon: 1196 bp. Deletion size: 647 bp. Deletion left flank: ACTGTTATATCAAATATGGAAACTGATTTG. Deletion right flank: AAGATTTAGTTGATGAAGAAGATAGAGGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2162 C. elegans Y53C12C.1(ok2201) II. Show Description
Y53C12C.1. External left primer: GAACTTCGAAAATGGGCAAA. External right primer: TGATGCCGCCATATATTCAA. Internal left primer: ATCAATCAAGAATGCCCACC. Internal right primer: TTCACTCACGGTTTACCACG. Internal WT amplicon: 2128 bp. Deletion size: 1210 bp. Deletion left flank: AAAAAGTTTGAGTAGACTTTAACTGAGTAT. Deletion right flank: TTAATATAATTCAATTAATTCATCAGGTAA. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2163 C. elegans C27B7.6(ok2515) IV. Show Description
C27B7.6. External left primer: AGAAGGAGCCAAACGTGAGA. External right primer: AGGCAGGTATGAGGTAGGCA. Internal left primer: GTCAATCGAGACACGCAGAA. Internal right primer: GCTAGGAATGAAATAGGCACG. Internal WT amplicon: 3109 bp. Deletion size: 2657 bp. Deletion left flank: CTTCATTCAAAGGAAATCTACGCATTTTCA. Deletion right flank: TTCCTAGCTACATGCCTACCTCATACCTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2164 C. elegans sdz-1&vps-33.1(ok2494) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
B0303.8, B0303.9. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2494 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAGCCCTGGAAGACATTGAT. External right primer: AGTGAAACCATTGTCGGAGC. Internal left primer: ACCACCATACGGATCTCCAA. Internal right primer: CGGACTTTTTGGTTTCGATT. Internal WT amplicon: 2348 bp. Deletion size: 1060 bp. Deletion left flank: GAGTTTGGTATCCAGGTGTTGAAGTTTGAA. Deletion right flank: ACTGGGAAGGGACTGTTAGTTTTCTAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2166 C. elegans nuo-4(ok2483) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K04G7.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2483 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAACCCAAACGTGGCAATA. External right primer: TTGTTAAGACCATCATGCCG. Internal left primer: AAAAGTGTGCGTGGGGTAAT. Internal right primer: GTTCCATGAGCAAATTGGGA. Internal WT amplicon: 3154 bp. Deletion size: 1295 bp. Deletion left flank: TCTATTACTTAAAGCAAATTTTCAAATTGA. Deletion right flank: AGTCTAGAAACAATTATTTTGAAAGAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2167 C. elegans gck-2(ok2867) V. Show Description
ZC404.9. External left primer: TAGTCGATCCGCGTACACAA. External right primer: GGACCACTTTCGGAACTTCA. Internal left primer: AGATAGATTTCCATCCGGCA. Internal right primer: AAACTTTGCGTGGCTTGAAT. Internal WT amplicon: 1258 bp. Deletion size: 549 bp. Deletion left flank: TTCTTTCAGAATGATATCCTCGATTCAAAC. Deletion right flank: GTTTTTCAACACAAGCAACTTCCGGAGCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2168 C. elegans ZK337.1(ok2874) I. Show Description
ZK337.1. External left primer: TCCAGACGTGCTGACAACTC. External right primer: GGCGCTACTCCACCATTAAA. Internal left primer: TCAGCTTTTGGCGATAGTGAT. Internal right primer: GTCTTCCATGGCTGTGAGGT. Internal WT amplicon: 1142 bp. Deletion size: 360 bp. Deletion left flank: TCTCTCTCAATTATTCGTTGGTTAGTATCC. Deletion right flank: AAGTGGGCTTTTTTCAAATTTTTTCAAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2169 C. elegans abu-15(ok2878) V. Show Description
C03A7.4. External left primer: GAACCGGTTTACTGAGCAGC. External right primer: GTTAGCTTGGCAAGAGCAGG. Internal left primer: TATTGCGTTCCTTGCATGTG. Internal right primer: AGTTGCTGGTTGAGCAGCTT. Internal WT amplicon: 1101 bp. Deletion size: 793 bp. Deletion left flank: CAATCCGTGAAAAGAGACAGTGTGGATGTGCTCAGCCACAGCAGAGCCAATGCTCGTGC CAACAAGTTCAACAGACTCAGTCATGCTCGTGCCAATCTGCTCCAGTTCAACAACAATC CCCATCCTGCTCATGCGCTCAGCCACAACAAACTCAACAAGTTCAGGTACAGTTCATTA ACATATTCGCAAACCATTAAATCAAAAATTTTAG. Deletion right flank: AAACTGCCTGCCAATCATCATGCTCTAACTCA. Insertion Sequence: AAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2170 C. elegans C41D11.5(ok2879) I. Show Description
C41D11.5. External left primer: ATTCGGCTTTTGAGGGCTAT. External right primer: AGCGGCTCTTCACTGTCAAT. Internal left primer: AATGGATCCAATTGTCGGAA. Internal right primer: TCAAATTAATCGCTCGTCCC. Internal WT amplicon: 1275 bp. Deletion size: 879 bp. Deletion left flank: CACCATTCTGAGCCATTTTCCATCATTTCT. Deletion right flank: AAGACACTTTTAGAGATTTACGGAAGGCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2171 C. elegans tkr-1(ok2886) III. Show Description
C38C10.1. External left primer: TGGTCATGGTCGAATCCATA. External right primer: ACATTTTCCAATTCTTGCGG. Internal left primer: CTGCAATTGAATCGGAAACA. Internal right primer: TTTTGTTGCTCCGGATTTTC. Internal WT amplicon: 1214 bp. Deletion size: 755 bp. Deletion left flank: TACTATGACTGGTGGTATGGTGATCTATGT. Deletion right flank: ACTATCAAAAAATCAATGAAAATCCGGAGC. Insertion Sequence: GGTGATCTATGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2172 C. elegans C07G1.2(ok2531) IV. Show Description
C07G1.2. External left primer: TCGTGGCAATTGACTGTGAT. External right primer: CGCCGAATATGATGATGATG. Internal left primer: TTTTTGTGAATCTGGAAGAGAATG. Internal right primer: TTACTCACCCAAATCCGAGC. Internal WT amplicon: 1139 bp. Deletion size: 346 bp. Deletion left flank: TTATCCCAATGTTACATTCCACCATGTCCA. Deletion right flank: CTTCTGCTCTAACTAGCTATTTCTATTTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2174 C. elegans Y38H6C.17(ok2911) V. Show Description
Y38H6C.17. External left primer: CCGGTTGCTTACATGCCTAC. External right primer: GATTCGCCAATCTTCCAAAA. Internal left primer: AAGCAATACGTACCGGTCTACA. Internal right primer: AAAGTTTCCAAATTTTTCGGC. Internal WT amplicon: 1372 bp. Deletion size: 525 bp. Deletion left flank: ATATACCCAAAGAATCCTAGAAATGCATAA. Deletion right flank: CGTTGCCGAAAAATTTGGAAACTTTCTATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2175 C. elegans klo-1(ok2925) IV. Show Description
C50F7.10. External left primer: TCCGATCGACAGCTAACCTT. External right primer: AAAGGATCCAGTTTGCCTCA. Internal left primer: TTTCTCTCATTGAGGCTGGG. Internal right primer: TCATTCCGTCGATGTCTTGT. Internal WT amplicon: 1104 bp. Deletion size: 592 bp. Deletion left flank: GCCTGCATGTTTATTTCGTTGAAAGTTATC. Deletion right flank: AAAGACATAACCGAACAAGACATCGACGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2182 C. elegans spe-17(ok2593) IV/nT1 [qIs51] (IV;V). Show Description
ZK617.3. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2593 homozygotes (often sterile or nearly sterile, but population can be maintained). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCTGCACCTAACAATCAGC. External right primer: CAAGCGAACAGCAGTCACAT. Internal left primer: GCTTGAATTTTTGACTGTGGC. Internal right primer: GTTGTCGAATTATTGCGGCT. Internal WT amplicon: 1167 bp. Deletion size: 416 bp. Deletion left flank: AATTATTTCTCACTCTTTGAAATTATCAAG. Deletion right flank: TTAGTATTCTGGATGTTTGAGTGAGTAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2183 C. elegans ncbp-1(ok2787) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F37E3.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2787 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGAAAAATATCGGGCTTCAA. External right primer: CCTTCCAATCTGTCCAGGTG. Internal left primer: GCCATCTATCTCCCAAATCG. Internal right primer: ATTAAACCCCCGCTAAATCG. Internal WT amplicon: 1121 bp. Deletion size: 534 bp. Deletion left flank: CTCAAAATCTTGCTATTTTCCTTTGTGATC. Deletion right flank: GCGGATTGTTCCGCCTTTTCTGTAAGTGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2184 C. elegans +/mT1 II; rpb-2(ok2893)/mT1 [dpy-10(e128)] III. Show Description
C26E6.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2893 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGAAGCATGGCAAGAAGCAT. External right primer: GCTTTCTTTTGATCACCCCA. Internal left primer: ATGTGCAGCGAATTGTTGAG. Internal right primer: GACGCAGACATCAAGAGCAA. Internal WT amplicon: 1187 bp. Deletion size: 331 bp. Deletion left flank: GATTATGATTGTGTTCCGAGCGCTGGGATT. Deletion right flank: GGAAACAAAAGACTGGATTTAGCCGGACCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2185 C. elegans C06B8.7(ok2814) V. Show Description
C06B8.7. External left primer: TCACAGAGCGATGGTACTCG. External right primer: CCACCTCGAACCGTTTTCTA. Internal left primer: TGCAGATTCAAACCCATCAA. Internal right primer: TCCAACATTCCTTGCGTGTA. Internal WT amplicon: 1163 bp. Deletion size: 680 bp. Deletion left flank: GCTTAAAGCAGGAGAGACCAAAGCGTGCTT. Deletion right flank: TCTCCGAATGATCGTATCACACTGGCCAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2186 C. elegans F41G3.10(ok2840)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F41G3.10. Homozygous viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2840 homozygotes (sickly Unc with small broods, often Dpy, various morphological defects; population can be maintained with difficulty). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GGATCATTCGAGTGGGAAGA. External right primer: GTCCACTAAACTTTGCCCCA. Internal left primer: AAATTGAGGATGGATGACGC. Internal right primer: AAACTCCCACGAAATCATGC. Internal WT amplicon: 1146 bp. Deletion size: 795 bp. Deletion left flank: TGTTGCAATAAGAACGCATAGCTGTACAAT. Deletion right flank: GTGTCTAACTGTGAACGAGTGGGCTTTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2187 C. elegans ruvb-1(ok2847) V/nT1 [qIs51] (IV;V). Show Description
C27H6.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2847 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGTCCACGTCCTCTACCTGA. External right primer: GTCAAGGGACTCGGAATTGA. Internal left primer: TCTTCCACACGTTTGAGCAC. Internal right primer: CTACAGGCTGCTGGATTCGT. Internal WT amplicon: 1221 bp. Deletion size: 780 bp. Deletion left flank: CTCGAGCGCGCGATAGAGATAGGTAAAACA. Deletion right flank: AGCAATCAATACAGCTCGTCCGGCCATACA. Insertion Sequence: ATCAATACAATCAATACAATCAATACATCAATACAATTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2189 C. elegans K10D2.4&cid-1(ok2757) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K10D2.4, K10D2.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2757 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACCGCGATCTTTTC. External right primer: CATCAATGGTTGTACAGCGG. Internal left primer: AAATCTCAGCGGGAGTTTGA. Internal right primer: CCGGCCTGTAAGTTCAATGT. Internal WT amplicon: 1136 bp. Deletion size: 713 bp. Deletion left flank: AGGCTGAAACAACCTTCATTTTACTTTTGC. Deletion right flank: AATGAAGTATATTAGGCCCTTCGTATTGCT. Insertion Sequence: AAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2191 C. elegans Y54G11A.14(ok2884) II. Show Description
Y54G11A.14. External left primer: TCAGACCGGTCATGGTACAC. External right primer: GGCGCTACTCCACTTTTGAA. Internal left primer: AAAACGCGAAACTATCGAAAA. Internal right primer: AAAAACTTACGCCATCGCC. Internal WT amplicon: 1138 bp. Deletion size: 686 bp. Deletion left flank: AAATTCAGGATCTTGGCTCCTGGAACGCAA. Deletion right flank: TTCTTGTGGCGCGAGTTGGATGCGGAGGAG. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2192 C. elegans lpr-2(ok2915) IV. Show Description
T12A7.5. External left primer: GAAAATATTCGGCCTGCAAA. External right primer: GCACCAGTAGAGAACGGCTC. Internal left primer: CGAGTGCTAACTGTGGTTGC. Internal right primer: GGAATTTGACTGGAAAAGGG. Internal WT amplicon: 1155 bp. Deletion size: 436 bp. Deletion left flank: ATCTATCGAGAACTTCAAAAAGTTTGTGTG. Deletion right flank: TTTTTCAACAAGAATTTATCTTAAACTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2193 C. elegans ddl-1(ok2916) II. Show Description
F59E12.10. External left primer: TCACAAGTTCTGCTTGTGGC. External right primer: GCTCACTTCAAAGTACGCCC. Internal left primer: TTCATTTTGTCTGAAAGGGAAA. Internal right primer: TGAGCCGATTGAAGAAATCC. Internal WT amplicon: 1198 bp. Deletion size: 465 bp. Deletion left flank: TTTGAAATATTTACTATAAGCCGGGTCGTC. Deletion right flank: TGGAAATATGAAAAAGGCACAAACCATATA. Insertion Sequence: TTTGATAAGAACCGTCGTAGTATGTTCTTCTGGTTTCTCTTCCACTGTTTCCTCCACGA TTTGTGAAGAGCTGGGATTCGATTCGTGAATTTCGTCTATTTCTGGTGTTGATGATGGT GTGGCGGTGGTTGATTTATCCTCCAAACCCAAACGTTGATTTATCCTCCAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2194 C. elegans tub-2(ok2883) I. Show Description
Y71G12A.3. External left primer: AGGCGACTTCTCTCCCTCTC. External right primer: TCATCATTATCGCCGATTCA. Internal left primer: GTGTGTGTGTGTGTGTGCGT. Internal right primer: TCCTTTCCACCAACGGATTA. Internal WT amplicon: 1267 bp. Deletion size: 861 bp. Deletion left flank: CAGATGACCTTACCCGTTATAACTTTAACC. Deletion right flank: TGGATAAGCTGCCGATTCCACTCAAGGAGA. Insertion Sequence: GATAAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2195 C. elegans C04G2.8(ok2887) IV. Show Description
C04G2.8. External left primer: TGTCCTGGGTAGGTTGGGTA. External right primer: ATCCCGAATCTGTCCAATCA. Internal left primer: GACCTTTTCACGAGGCAATC. Internal right primer: GGTCCTTCGACAACCATAGC. Internal WT amplicon: 1315 bp. Deletion size: 407 bp. Deletion left flank: ATTGAAAACGATTGGATAGAGAAGTCAGCG. Deletion right flank: AATAAGAGCGACTTCTGGAGCGGCTTCTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2196 C. elegans T12G3.1(ok2892) IV. Show Description
T12G3.1. External left primer: AGGAAGAGTGTGCGCCTTTA. External right primer: AATTCAGCAGAGCTGGCTTC. Internal left primer: TGTCAACGGACCAATCTTTG. Internal right primer: CTTCTTGTTCAAGACGGGCT. Internal WT amplicon: 1199 bp. Deletion size: 795 bp. Deletion left flank: ATCAGTGAGCACTGAAACTGCCAAAAAAGC. Deletion right flank: AATGACCAAATTCGAAGAGAAAATGGATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2197 C. elegans sma-6(ok2894) II. Show Description
C32D5.2. External left primer: GCGTTGATCCAAAGGACAGT. External right primer: CAACTTTACGCTGCGATTGA. Internal left primer: TCGCAAAGCTCTGTATCGTG. Internal right primer: TCGGGGTTTTTGATCAACTC. Internal WT amplicon: 1159 bp. Deletion size: 304 bp. Deletion left flank: GTGGGAAGTTGCAATCAGGGTTGAGGTATG. Deletion right flank: GAAAAACGTCCCAGCACTTAATGAATTGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2198 C. elegans C25F6.6(ok2929) X. Show Description
C25F6.6. External left primer: AAAGACGATGGAGGCAAATG. External right primer: CCCCTAGGTGGCTTGACTTT. Internal left primer: CAACATCTTCACCGTCACCA. Internal right primer: CAACGTCACAATTCACTTGC. Internal WT amplicon: 1278 bp. Deletion size: 365 bp. Deletion left flank: CAAACTTCTGAGTGAAAAGTTTAATGTCAG. Deletion right flank: ATCATCATTTGGGAAAAAGGAGTGGATCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807