| SHG2901 |
C. elegans |
csr-1(ust400[mCherry::csr-1]) IV. Show Description
mCherry inserted into endogenous csr-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.
|
|
| SHG2903 |
C. elegans |
lotr-1(ust585[lotr-1::GFP::3xFlag]) I. Show Description
GFP::3xFlag inserted into endogenous lotr-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.
|
|
| SHG2904 |
C. elegans |
npp-9(ust587[tagRFP::npp-9]) III. Show Description
tagRFP inserted into endogenous npp-9 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.
|
|
| SHG2905 |
C. elegans |
pgl-1(ust588[pgl-1::GFP::3xFlag]) IV. Show Description
GFP::3xFlag inserted into endogenous pgl-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.
|
|
| SHG2906 |
C. elegans |
rnp-9(ust589[rnp-8::GFP::3xFlag]) I. Show Description
GFP::3xFlag inserted into endogenous rnp-8 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.
|
|
| SHG2907 |
C. elegans |
rrf-1(ust590[rrf-1::GFP::3xFlag]) I. Show Description
GFP::3xFlag inserted into endogenous rrf-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.
|
|
| SHG2908 |
C. elegans |
rsd-6(ust591[3xFlag::GFP::rsd-6]) I. Show Description
3xFlag::GFP inserted into endogenous rsd-6 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.
|
|
| SHG2909 |
C. elegans |
znfx-1(ust362[mCherry::znfx-1]) II. Show Description
mCherry inserted into endogenous znfx-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544.
|
|
| SHG2957 |
C. elegans |
gld-4(ust593[3xFlag::GFP::gld-4]) I. Show Description
3xFlag::GFP inserted into endogenous gld-4 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.
|
|
| SHG3112 |
C. elegans |
dcr-1(ust624[dcr-1::GFP::3xFlag]) III. Show Description
GFP::3xFlag inserted into endogenous dcr-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.
|
|
| SHG3113 |
C. elegans |
hrde-2(ust625[hrde-2::GFP::3xFlag]) V. Show Description
GFP::3xFlag inserted into endogenous hrde-2 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.
|
|
| SHG3114 |
C. elegans |
deps-1(ust626[deps-1::tagRFP]) I. Show Description
tagRFP inserted into endogenous deps-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.
|
|
| SHG3115 |
C. elegans |
gld-1(ust627[3xFlag::GFP::gld-1]) I. Show Description
3xFlag::GFP inserted into endogenous gld-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.
|
|
| SHG3116 |
C. elegans |
simr-1(ust618[simr-1::GFP::3xFlag]) I. Show Description
GFP::3xFlag inserted into endogenous simr-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.
|
|
| SHG357 |
C. elegans |
ustSi32 II. Show Description
ustSi32 [tofu-6p::tofu-6::GFP::3xFlag::tofu-6 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475.
|
|
| SHG487 |
C. elegans |
ustSi25 II. Show Description
ustSi25 [wago-4p::3xFlag::GFP::wago-4::wago-4 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Xu F, et al. Cell rep. 2018 May 22;23(8):2482-2494. doi: 10.1016/j.celrep.2018.04.072. PMID: 29791857.
|
|
| SHG520 |
C. elegans |
ustSi56 II. Show Description
ustSi56 [tofu-6p::tofu-6::mCherry::tofu-6 3'UTR + Cbr-unc-119(+)] II. Inserted into oxTi444 of parental strain EG8080. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475.
|
|
| SHG542 |
C. elegans |
ustSi60 II. Show Description
ustSi60 [pics-1p::pics-1::GFP::3xFlag::pics-1 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475.
|
|
| SHG578 |
C. elegans |
ustSi64 II. Show Description
ustSi64 [wago-3p::3xFlag::GFP::wago-3::wago-3 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.
|
|
| SHG659 |
C. elegans |
ustSi106 II. Show Description
ustSi106 [wago-1p::3xFlag::GFP::wago-1::wago-1 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544.
|
|
| SHG670 |
C. elegans |
ustSi55 II. Show Description
ustSi55 [pid-1p::pid-1::GFP::3xFlag::pid-1 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475.
|
|
| SHG833 |
C. elegans |
glh-1(ust338[3xFlag::GFP::glh-1]) I. Show Description
3xFlag::GFP inserted into endogenous glh-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.
|
|
| SHX3908 |
C. elegans |
C42D4.3(zju273[C42D4.3::8×MS2]) IV; zjuEx2144. Show Description
8xMS2 tag inserted at C-terminus of endogenous C42D4.3 locus. zjuEx2144 [semo-1p::MCP::24×Suntag + col-19p::scFv::sfGFP + ttx-3p::RFP]. Pick ttx-3::RFP+ animals to maintain. MS2-based signal Amplification with Suntag System (MASS). Enhanced MS2-based single-molecule RNA imaging system utilizes Suntag signal amplifier. Suntag is a 19 amino acid protein tag that binds to its specific single-chain variable fragment (scFv) antibody. zjuEx2144 transgene expression provides MS2 coat protein (MCP) fused to 24xSuntag and scFv tagged with GFP. When all the required elements of the MASS (MS2, MCP, 24xSuntag, and scFv antibodies) are present, bright GFP foci will mark the tagged RNA. Reference: Hu Y, et al. eLife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. PMID: 36867026.
|
|
| SHX3909 |
C. elegans |
mai-1(zju271[mai-1::8×MS2]) X; zjuEx2144. Show Description
8xMS2 tag inserted at C-terminus of endogenous mai-1 locus. zjuEx2144 [semo-1p::MCP::24×Suntag + col-19p::scFv::sfGFP + ttx-3p::RFP]. Pick ttx-3::RFP+ animals to maintain. MS2-based signal Amplification with Suntag System (MASS). Enhanced MS2-based single-molecule RNA imaging system utilizes Suntag signal amplifier. Suntag is a 19 amino acid protein tag that binds to its specific single-chain variable fragment (scFv) antibody. zjuEx2144 transgene expression provides MS2 coat protein (MCP) fused to 24xSuntag and scFv tagged with GFP. When all the required elements of the MASS (MS2, MCP, 24xSuntag, and scFv antibodies) are present, bright GFP foci will mark the tagged RNA. Reference: Hu Y, et al. eLife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. PMID: 36867026.
|
|
| SHX4319 |
C. elegans |
zjuEx2429. Show Description
zjuEx2429 [col-19p::BFP::8xMS2 + semo-1p::MCP::24×Suntag + col-19p::scFv::sfGFP + myo-2p::GFP]. Pick GFP+ (pharynx) animals to maintain. MS2-based signal Amplification with Suntag System (MASS). Enhanced MS2-based single-molecule RNA imaging system utilizes Suntag signal amplifier. Suntag is a 19 amino acid protein tag that binds to its specific single-chain variable fragment (scFv) antibody. When all the required elements of the MASS (MS2, MCP, 24xSuntag, and scFv antibodies) are present, bright GFP foci will mark the tagged RNA. Reference: Hu Y, et al. eLife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. PMID: 36867026.
|
|
| SJ30 |
C. elegans |
ire-1(zc14) II; zcIs4 V. Show Description
zcIs4 [hsp-4::GFP] V. Animals contain a missense mutation (G739R) in the kinase domain of ire-1. They are unable to induce hsp-4(BiP0 in response to tumincamycin, or heat shock.
|
|
| SJ4005 |
C. elegans |
zcIs4 V. Show Description
zcIs4 [hsp-4::GFP] V. The hsp-4::GFP reporter integrated within the cluster of LG V. Animals express low levels of GFP under basal conditions. However, expression in the gut and hypodermis can increase in response to tunicamycin treatment or heat shock.
|
|
| SJ4058 |
C. elegans |
zcIs9 V. Show Description
zcIs9 [hsp-60::GFP + lin-15(+)]. Stable transgenic line with low basal GFP expression, mainly in the tail, observed from L1 to adult. Induced by perturbations of mitochondrial folding environment.
|
|
| SJ4100 |
C. elegans |
zcIs13 V. Show Description
zcIs13 [hsp-6p::GFP + lin-15(+)]. Stable transgenic line with GFP expression mainly in the tail, observed from L1 to adult. Induced by perturbations of mitochondrial folding environment.
|
|
| SJ4103 |
C. elegans |
zcIs14. Show Description
zcIs14 [myo-3::GFP(mit)]. Stable transgenic line expressing GFP at high levels in mitochondria of body wall muscle. Slight developmental delay and reduced brood size observed.
|
|
| SJ4143 |
C. elegans |
zcIs17. Show Description
zcIs17 [ges-1::GFP(mit)]. Stable transgenic line expressing GFP in mitochondria of intestinal cells.
|
|
| SJ4144 |
C. elegans |
zcIs18. Show Description
zcIs18 [ges-1::GFP(cyt)]. Stable transgenic line expressing GFP in cytosol of intestinal cells.
|
|
| SJ6 |
C. elegans |
zcIs4 V; irg-7(zc6) X. Show Description
zcIs4 [hsp-4::GFP] V. The identity of upr-1 remains unknown. Animals containing the zc6 mutation can be detected in an hsp-4::GFP background by following the bright green tails under fluorescence microscopy.
|
|
| SJZ106 |
C elegans |
foxSi27 I. Show Description
foxSi27 [pie-1p::tomm-20(gDNA)::mKate2::HA::tbb-2 3'UTR ] I. Single-copy MosSCI insertion into oxti185. Germline-specific expression of TOMM-20::mKate2::HA can be used for fluorescent identification of germline mitochondrial morphology and tissue-specific isolation of mitochondria. Reference: Ahier A, et al. Nature Cell Biol. 2018 Mar;20(3):352-360. doi: 10.1038/s41556-017-0023-x. PMID: 29358705.
|
|
| SJZ204 |
C. elegans |
foxSi37 I. Show Description
foxSi37 [ges-1p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Gut-specific expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.
|
|
| SJZ206 |
C. elegans |
foxSi39 I. Show Description
foxSi39 [gcy-6p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. ASE-specific expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.
|
|
| SJZ213 |
C. elegans |
foxSi41 I. Show Description
foxSi41 [dpy-7p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Hypodermal expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.
|
|
| SJZ216 |
C. elegans |
foxSi44 I. Show Description
foxSi44 [rgef-1p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Neuronal expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.
|
|
| SJZ328 |
C. elegans |
foxSi75 I. Show Description
foxSi75 [eft-3p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Ubiquitous expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.
|
|
| SJZ47 |
C. elegans |
foxSi16 I. Show Description
foxSi16 [myo-3p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Muscular expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.
|
|
| SL536 |
C. elegans |
dxDf2/spe-9(eb19) unc-101(m1) I. Show Description
Heterozygotes are Unc and segregate Uncs, Sterile Uncs and dead eggs. Strain is sick and grows slowly. dxDf2 fails to complement unc-54, so it could delete the entire right arm of LG I.
|
|
| SLR246 |
C. elegans |
unc-119(ed3) III; stxEx39. Show Description
stxEx39 [alx-1::TY1::eGFP::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. Constitutive expression of GFP. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of alx-1 coding sequence in fosmid WRM064D_F05 by recombineering (TransgeneOme bacterial clone 095794875301489 F02). Reference: Radetskaya O, et al. The PMK-3 (p38) Mitochondrial Retrograde Response Functions in Intestinal Cells to Extend Life via the ESCRT Machinery. bioRxiv 797308; doi: https://doi.org/10.1101/797308
|
|
| SLR247 |
C. elegans |
unc-119(ed3) III; stxEx48. Show Description
stxEx48 [C01A2.4::TY1::eGFP::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. Constitutive expression of GFP. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of C01A2.4 coding sequence in fosmid WRM061C_F01 by recombineering (TransgeneOme bacterial clone 7225558184899882 D12). Reference: Radetskaya O, et al. The PMK-3 (p38) Mitochondrial Retrograde Response Functions in Intestinal Cells to Extend Life via the ESCRT Machinery. bioRxiv 797308; doi: https://doi.org/10.1101/797308
|
|
| SLR248 |
C. elegans |
unc-119(ed3) III; stxEx35. Show Description
stxEx35 [istr-1::TY1::eGFP::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. Constitutive expression of GFP. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of istr-1 coding sequence in fosmid WRM0636D_F01 by recombineering (TransgeneOme bacterial clone 5438954842362824 D10). Reference: Radetskaya O, et al. The PMK-3 (p38) Mitochondrial Retrograde Response Functions in Intestinal Cells to Extend Life via the ESCRT Machinery. bioRxiv 797308; doi: https://doi.org/10.1101/797308
|
|
| SM1508 |
C. elegans |
mxl-2(tm1516) III; bar-1(ga80) X. Show Description
Most defects are similar to bar-1(ga80) single mutant animals [bar-1(ga80) hermaphrodites are usually Egl and often have a protruding vulva (Pvl), although approx. 40% of animals appear WT on plates. Also slightly Unc. In bar-1(ga80) hermaphrodites any of the six vulval precursor cells (P3.p - P8.p) can sometimes fuse with hyp7 without dividing, and P5.p - P7.p can adopt the tertiary cell fate instead of the primary or secondary fates. In addition, the neuroblast QL and its progeny migrate towards the anterior instead of the posterior, and the cell P12 usually adopts the fate of P11. bar-1(ga80) do mate, but poorly. bar-1 encodes a beta-catenin molecule and the ga80 mutation is predicted to cause an early truncation of the protein.] Increased severity of ray 1 displacement.
|
|
| SM1586 |
C. elegans |
mxl-2(tm1516) III; plx-1(nc37) IV; him-5(e1490) V. Show Description
Hermaphrodites seem fine. Males have a high penetrance of anterior displacement of ray 1.
|
|
| SM190 |
C. elegans |
smg-1(cc546) I; pha-4(zu225) V. Show Description
Dies at 15-20C with mostly dead embyros and a few dead larvae. Grows best at 24C. Survives at 25C, but worms look sick (often small and clear) and have very reduced brood sizes. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
| SM481 |
C. elegans |
pxIs10. Show Description
pxIs10 [pha-4::GFP::CAAX + rol-6(su1006)]. Roller line that has GFP localized to the plasma membrane of the pharynx, gut and rectal cells in embryos and the somatic gonad during L2-L3 larval stage and beyond. Reference: Portereiko MF & Mango SE. Dev Biol. 2001 May 15;233(2):482-94.
|
|
| SOL19 |
C. elegans |
ceh-38(tm321) II; ceh-44(ot1028) III; ceh-48(tm6112) IV; otIs669 him-5(e1490) V; otDf1 X. Show Description
NeuroPAL landmark reporter in a sextuple CUT mutant background. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). otDf1 is a deletion affecting ceh-41, ceh-21, T26C11.9, and ceh-39. Reporter expression is affected in this mutant, suggesting alterations in neuronal identity.
|
|
| SP1196 |
C. elegans |
dyf-7(m539) X. Show Description
Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective. Animals slightly short.
|
|