| VC2838 |
C. elegans |
+/mT1 II; F09G8.3(ok3529)/mT1 [dpy-10(e128)] III. Show Description
F009G8.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3529 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACAACATGTGGCGATGATG. External right primer: GCTTCTTTCGTTTTTCCGTG. Internal left primer: GCAGAGTTCGAGACAGGACG. Internal right primer: CTCATTCCTCCACTTCGCAT. Internal WT amplicon: 1193 bp. Deletion size: 753 bp. Deletion left flank: AGACAGGACGTCGACATCTTGCCAAAATGA. Deletion right flank: ATTTTTAATTAAACAAATTTTCTCTAATTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2841 |
C. elegans |
mboa-6(gk1217)/sC1 [dpy-1(s2170)] III. Show Description
R155.1. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and gk1217 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTAGCAAATTTTTGCGGG. External right primer: AAGTACGCAAACACCTTGGC. Internal left primer: GCTAACTCGGCCTTTACACG. Internal right primer: TTTGGAAACCCGTTGGATTA. Internal WT amplicon: 2401 bp. Deletion size: 1464 bp. Deletion left flank: GTCGATTGGACCCAAAAAATAGAATTTTCA. Deletion right flank: GTGAAAAAGTACAAGAAATTCAACTTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2853 |
C. elegans |
+/mT1 II; pst-2(ok3603)/mT1 [dpy-10(e128)] III. Show Description
F54E7.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3603 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGGCATAACACGAAACGAA. External right primer: ACCCGAGCCCTGATAAAAAG. Internal left primer: GCGATTTGTGCGTCAGTAAA. Internal right primer: TTTAAGTTCTAAACCGTCATTGG. Internal WT amplicon: 1236 bp. Deletion size: 437 bp. Deletion left flank: ACTTTCGAATGCATCCGTTGGATATTTAAA. Deletion right flank: CTACGCACTGATCCTCTCATGTCTTGGATA. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC286 |
C. elegans |
+/szT1 [lon-2(e678)] I; pgp-7(ok528)/szT1 X. Show Description
T21E8.2. Heterozygotes are WT and segregate WT, arrested szT1 aneuploid progeny, Lon-2 males, and homozygous ok528 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2862 |
C. elegans |
+/szT1 [lon-2(e678)] I; utx-1(ok3553)/szT1 X. Show Description
D2021.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3553 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATGGATATCAGCGCTCAGG. External right primer: TTGCTACTTGCCAGCACATT. Internal left primer: CAAATGGTTCATAGAAGAACTCAGC. Internal right primer: CTGTTGAAAGTTGAGTGGCG. Internal WT amplicon: 1147 bp. Deletion size: 554 bp. Deletion left flank: GACAATAGGAAGGAAGCTCAAAGTCTGGAA. Deletion right flank: TGGGGCACCAAGTTCACGGCATGAATACTG. Insertion Sequence: AGTCTGGAAAGTCTGGAAAAGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2896 |
C. elegans |
F32A7.4(ok3586)/hIn1 [unc-101(sy241)] I. Show Description
F32A7.4. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3586 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATTGTGCGTTATTTCGGAGC. External right primer: CTTTCATCCGTCATTGCTCA. Internal left primer: GACTATTTCTTCGACATTTTATTGC. Internal right primer: GGGTAGATTTTGAAAAAGAAACG. Internal WT amplicon: 1238 bp. Deletion size: 539 bp. Deletion left flank: ATTTGAGGTAAACGAAAAAATAATATAAAA. Deletion right flank: GGCAAGATTAGCCCCAAACTATGCAGAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2897 |
C. elegans |
gpi-1(ok3599)/hIn1 [unc-101(sy241)] I. Show Description
Y87G2A.8. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3599 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGTCTGAGCCTCAACCAAAA. External right primer: CTCTCACTCAAAATGCGGGT. Internal left primer: CAGAATTTTGAGAAAATCCAACG. Internal right primer: AGTTTGTAGCCCCTCAGCCT. Internal WT amplicon: 1205 bp. Deletion size: 621 bp. Deletion left flank: ACCAAATCGGACCGAATGTGCACTTCGTGT. Deletion right flank: ATCAGTTGATTCATCAGGGTACTCGACTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC291 |
C. elegans |
tag-51(ok474)/sC1 [dpy-1(s2170)] III. Show Description
K02F3.1, K02F3.12. Heterozygotes are WT, and segregate WT, Dpy sC1 homozygotes, and ok474 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC292 |
C. elegans |
+/nT1 IV; sun-1(gk199)/nT1 V. Show Description
F57B1.2. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous gk199 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2942 |
C. elegans |
+/mT1 II; B0285.1(ok3664)/mT1 [dpy-10(e128)] III. Show Description
B0285.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3664 homozygotes (arrest stage/phenotype undetermined). Note: mT1 may have acquired an early lethal in this strain, so mT1 homozygotes may not be seen. Pick WT and check for correct segregation of progeny to maintain. External left primer: TGACATTCATTTTGCCGCTA. External right primer: TCCTTCTCCCATAGTCGTGC. Internal left primer: CTTAGCTCCATACCACCACCA. Internal right primer: CTCGCCTCTGCAAACAATTT. Internal WT amplicon: 1354 bp. Deletion size: 632 bp. Deletion left flank: GATAGCCACTCGGCCTGTGTAAGTTATTTG. Deletion right flank: TTCATCATAAGAATATCGTCCGTCTTATGG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2961 |
C. elegans |
ttx-1(ok2889)/unc-51(e369) rol-9(sc148) V. Show Description
Y113G7A.6. Apparent homozygous lethal deletion chromosome balanced by flanking markers. Heterozygotes are WT and segregate WT, Unc-51 Rol-9 homozygotes and ok2889 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCTCGGGGAGTTGAATTTTG. External right primer: TTTTTCCCGAATTTTTGCAC. Internal left primer: ATGTCTTCCCGCATGAAAAT. Internal right primer: CCAGTGGTCAGAAAGCCAAT. Internal WT amplicon: 1294 bp. Deletion size: 888 bp. Deletion left flank: GTTGTTTTCTAGAAAATCTGAAAATTTTTA. Deletion right flank: TTACGAATATGAAATTTATCAAGGTCTAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2971 |
C. elegans |
spe-19(ok3428)/unc-51(e369) rol-9(sc148) V. Show Description
Y113G7A.10. Apparent homozygous lethal deletion chromosome balanced by flanking markers. Heterozygotes are WT and segregate WT, Unc-51 Rol-9 homozygotes and ok3428 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CAAAACGTCCAAAGTGTCCC. External right primer: AGTGATTCCCAGATGTCCCA. Internal left primer: TCTCCGAAATGTCCCAGAAA. Internal right primer: CGAAAAATTCGGAAAAATCG. Internal WT amplicon: 1373 bp. Deletion size: 810 bp. Deletion left flank: ACGTCATCCTCCTGAGTTTTTTCGACTTTC. Deletion right flank: TTAAGCCTATTGAAAAGCTCTGAATTGTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2972 |
C. elegans |
R148.3(ok3525)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
R148.3. Apparent homozygous lethal deletion chromosome balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and ok3525 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGAGACAACAGTGAGCCGAC. External right primer: GCTGCCTTCCATGACTTCTC. Internal left primer: CTCATGCTCAACGTCAGGAA. Internal right primer: TGTCGATCGTCTTCTCATCG. Internal WT amplicon: 1190 bp. Deletion size: 862 bp. Deletion left flank: GACGGCGGAGAATCGAGATTTGACAGATAA. Deletion right flank: TCATCGATGAGAAGACGATCGACACGTCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC298 |
C. elegans |
+/szT1 [lon-2(e678)] I; inx-3(ok481)/szT1 X. Show Description
F22F4.2. Heterozygotes are WT and segregate WT, arrested szT1 aneuploid progeny, Lon-2 males, and homozygous ok481 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC301 |
C. elegans |
ant-1.1(gk172)/eT1 III; +/eT1 V. Show Description
T27E9.1. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk172 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC302 |
C. elegans |
rib-1(ok556)/nT1 IV; +/nT1 V. Show Description
F12F6.3. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok556 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC303 |
C. elegans |
+/nT1 IV; stdh-4(ok543)/nT1 V. Show Description
F25G6.5. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok543 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3049 |
C. elegans |
hel-1(ok3698)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
C26D10.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3698 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CAACCAAGTTCTGGCCATCT. External right primer: TTCCATTCTCCTTCCACCTG. Internal left primer: GGCGGAGAACATCATCACTT. Internal right primer: TTTCGGATCGTTTCGCTACT. Internal WT amplicon: 1141 bp. Deletion size: 721 bp. Deletion left flank: TGTCGCACTCGTCCAGGACGAAGTACTTGA. Deletion right flank: GAAATTTAGTAAATAACCTCACAAAAACAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3060 |
C. elegans |
+/szT1 [lon-2(e678)] I; C33A11.1(ok3681)/szT1 X. Show Description
C33A11.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3681 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCTGGTTGTCCTTTGCTGTT. External right primer: CTGTTACGCTGTGCTGGAAA. Internal left primer: ACATGGGTTTGTCCCTTTTT. Internal right primer: CCCCCATAATTTTCATATCACG. Internal WT amplicon: 1298 bp. Deletion size: 1022 bp. Deletion left flank: TCATTTTTATTTGAATCATCAACTTTTAAA. Deletion right flank: AGCTCAAGATGAAAAAAGAAAAAGAGCAGG. Insertion Sequence: ATATTTTGACTTCCTTTTTTATTTTTTTTTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3071 |
C. elegans |
hsf-1(ok600)/hIn1 [unc-101(sy241)] I. Show Description
Y53C10A.12. Replaces strain VC358. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok600 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CAAACAACAAATCCTCGGCT. External right primer: GCTCAATGCGTCAACAACAT. Internal left primer: GTGGATGAGGTGGAAGTCGT. Internal right primer: GTCGCGAAACGGTAATCAAT. Internal WT amplicon: 2605 bp. Deletion size: 877 bp. Deletion left flank: ATGAGTCAATGGACCGGATCCCATGTACAT. Deletion right flank: TTCTAAGAAATTTTTATTTTCTGAAAAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC309 |
C. elegans |
tag-65(ok535) V/nT1 (IV;V). Show Description
F58G11.5. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok535 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3111 |
C. elegans |
gpb-2(ok3691)/szT1 [lon-2(e678)] I; +/szT1 X. Show Description
F52A8.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3691 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATAATCAAGCCCAAATGCG. External right primer: CCAACAACTTGGGTTATGGC. Internal left primer: TTCCATCAGGAGAAGTTCGG. Internal right primer: ATCGCTTGCGGGTAAGATTT. Internal WT amplicon: 1318 bp. Deletion size: 393 bp. Deletion left flank: TTGTCACTTCTTCTCGAGGAGTACACTAGC. Deletion right flank: ACATGTTGAATCTCCACTTCCAGTTAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3118 |
C. elegans |
M05B5.2(ok3716)/szT1 [lon-2(e678)] I; +/szT1 X. Show Description
M05B5.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3716 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGGCAGTTTCAGGGTTCAAA. External right primer: CTAAGGCACTTGGCTTTTGC. Internal left primer: GGGAGGAAATTTCAAAAATGA. Internal right primer: AAAAATTTAACGCGTCGCTG. Internal WT amplicon: 1169 bp. Deletion size: 569 bp. Deletion left flank: GGAATGGCAAATTGACAGCATGAGGGTTTC. Deletion right flank: TTTTTGGGATGTTCAGCGACGCGTTAAATT. Insertion Sequence: TTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3119 |
C. elegans |
+/mT1 II; C07A9.4(ok3733)/mT1 [dpy-10(e128)] III. Show Description
C07A9.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3733 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTGCGATGTTTGAAAACGAA. External right primer: TTTCGGGTTGCCGAATAATA. Internal left primer: TCTTCTATTGGCAATGCAACC. Internal right primer: CTGTGAAGGTGGTGGTTACG. Internal WT amplicon: 1278 bp. Deletion size: 537 bp. Deletion left flank: CAAAATGCCAAAAATGCTAGAGCAACAAGA. Deletion right flank: ATAACACCAACATGTAGATGACCCCGGTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC312 |
C. elegans |
+/mT1 II; sel-8(ok387)/mT1 [dpy-10(e128)] III. Show Description
C32A3.1. Heterozygotes are WT and segregate WT, arrested mT1 aneuploid progeny, sterile Dpy-10 mT1 homozygotes, and homozygous ok387 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC313 |
C. elegans |
+/nT1 IV; ttn-1(gk171)/nT1 V. Show Description
W06H8.8. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous gk171 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC315 |
C. elegans |
+/eT1 III; mrck-1(ok586)/eT1 V. Show Description
K08B12.5. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous ok586 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC316 |
C. elegans |
+/mT1 II; npp-10(ok467)/mT1 [dpy-10(e128)] III. Show Description
ZK328.5b. Heterozygotes are sickly WT and segregate WT, arrested mT1 aneuploid progeny, sterile Dpy-10 mT1 homozygotes, and homozygous ok467 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3162 |
C. elegans |
+/szT1 [lon-2(e678)] I; dnj-14&glit-1(ok237)/szT1 X. Show Description
F55D10.3, K02G10.8. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok237 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGTGTTCGGTAAGCATTGGG. External right primer: AAAGTGTGTTCCGTCCTTGG. Internal left primer: CTGCCGTGGAATCTACCTGT. Internal right primer: GCAGTCGAACAACCACTTCA. Internal WT amplicon: 3216 bp. Deletion size: 2229 bp. Deletion left flank: TTTTGAGAAGGCGGTGGAGGCATGGCAATC. Deletion right flank: TTCGCTAAAAAATTGAGCCAATTTATTATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3166 |
C. elegans |
+/mT1 II; arx-3(ok1122)/mT1 [dpy-10(e128)] III. Show Description
Y79H2A.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1122 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTTGGAAATCGTTTTGGCAT. External right primer: TTAAAACTCCGGCCAATCAG. Internal left primer: AACCACTTTTCCTCGTCCCT. Internal right primer: TTTTCGTGGCAAATTCCTTC. Internal WT amplicon: 2630 bp. Deletion size: 1688 bp. Deletion left flank: TTTTCCACCGATTTTTAATGTTTTCGATGT. Deletion right flank: GTTTTTGCGGTTAAGCCGGTCGAAATTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3167 |
C. elegans |
+/szT1 [lon-2(e678)] I; hlh-8(ok1248)/szT1 X. Show Description
C02B8.4. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1248 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTCCGCGGTAATTTTTCAAC. External right primer: GCATCAGACAGTGTGGAGGA. Internal left primer: CCTTTCTTTTCACCGAGCAG. Internal right primer: GAGGGGGAATATGTGCTGAA. Internal WT amplicon: 3385 bp. Deletion size: 2391 bp. Deletion left flank: GAGCATGTGCCAACAGACGGGAACGTCAAA. Deletion right flank: AACATGTTCATAAACTTAGCATTTTCCGCT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC317 |
C. elegans |
hgrs-1(ok579)/nT1 IV; +/nT1 V. Show Description
C07G1.5. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok579 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3182 |
C. elegans |
kbp-3(ok3713)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
F26H11.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3713 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATCGTCTTCTTCGTCGTCGT. External right primer: ATCGGCTTTTCTCAAGTGGA. Internal left primer: TCGTCTTCCTCATCATCATCC. Internal right primer: TGCTAATTTTGCTGTCGCAT. Internal WT amplicon: 1133 bp. Deletion size: 434 bp. Deletion left flank: CAAAATTTTTACCGCTCTTCAGTGCCGCCC. Deletion right flank: ACATCTAAACAATTTCCTTGCAAATTTACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC319 |
C. elegans |
+/mT1 II; tbx-2(ok529)/mT1 [dpy-10(e128)] III. Show Description
F21H11.3. Heterozygotes are WT and segregate WT, arrested mT1 aneuploid progeny, sterile Dpy-10 mT1 homozygotes, and homozygous ok529 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3192 |
C. elegans |
Y50D7A.4(gk3089)/sC1 [dpy-1(s2170)] III. Show Description
Y50D7A.4. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and gk3089 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTATCCGAATTTTCTGCGG. External right primer: ATTTTCAACGGAATTCGACG. Internal left primer: GAAAATTTTGCATTTTCAAGGC. Internal right primer: TCCGCGATTTTTATAGCATTTT. Internal WT amplicon: 940 bp. Deletion size: 647 bp. Deletion left flank: TTTTGTCAAGCCTCAAATCCCACAATTTTG. Deletion right flank: ATAAATGAGCCAAAATTCGTCAAATTCTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3209 |
C. elegans |
Y48G10A.4(gk3088)/hIn1 [unc-101(sy241)] I. Show Description
Y48G10A.4. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and gk3088 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTAATTGTTCGGCGAATTTT. External right primer: AAACATTTTCAACCCTGCAAGT. Internal left primer: ATACGTCACCCGAGCAATTC. Internal right primer: CAACCAGAATGCAGAGCAAA. Internal WT amplicon: 1226 bp. Deletion size: 763 bp. Deletion left flank: CCAGTATAGATTGAATAACTTTAAAAATTT. Deletion right flank: AAAATGCTCCACGTACGCATTCTCATGATT. Insertion Sequence: AACTATAGTTATTTAAATTCTTACTGTAGTTTTCGCTAAGTGATATCGCGCGTCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC321 |
C. elegans |
nhr-105(ok473)/nT1 IV; +/nT1 V. Show Description
C06G3.1. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok473 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC322 |
C. elegans |
+/nT1 IV; cpl-1(ok360)/nT1 V. Show Description
T03E6.7. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok360 hermaphrodites (arrest stage/phenotype undetermined, but possibly sterile). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3220 |
C. elegans |
pfs-2(ok3744)/mT1 II; +/mT1[dpy-10(e128)] III. Show Description
R06A4.9. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3744 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTTGTGTCTGGTGGTGGA. External right primer: GATGATTGTTGTTGTTGCGG. Internal left primer: TGGTTCAATAGTCTACTGGATGGT. Internal right primer: AACGAAAAACCAACCCTTCC. Internal WT amplicon: 1161 bp. Deletion size: 688 bp. Deletion left flank: GGCGACACTGTTGAAGACATTTTTGGATTG. Deletion right flank: CATCTCAGCAAGGACCTCCTCCACGACAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3221 |
C. elegans |
C01A2.5(gk3070)/hIn1 [unc-101(sy241)] I. Show Description
C01A2.5. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and gk3070 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TAAATATAATACCGTGCGTGCG. External right primer: TCAAAGTCATGTTTCCGTATCG. Internal left primer: GGCTCAGGGTAAATAGACATGG. Internal right primer: TTTAAATGGGTTTGAATCTGGG. Internal WT amplicon: 1458 bp. Deletion size: 510 bp. Deletion left flank: ATTGCAAAAGTGGGCGGGGCGTCGTTTCGT. Deletion right flank: ATCAACTCGATTTTGAGCAAAACTATCTCG. Insertion Sequence: TAGTTATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3223 |
C. elegans |
+/mT1 II; atf-7(gk3083)/mT1 [dpy-10(e128)] III. Show Description
C07G2.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk3083 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTCCATTCGTGTTTCGATGA. External right primer: AGTTATCCCCACCGCTTTTT. Internal left primer: AACCGGAAAAATTCCAAACC. Internal right primer: CTTCTTCGCCGTTTCACTTC. Internal WT amplicon: 2013 bp. Deletion size: 836 bp. Deletion left flank: CCGTTTTGTGGACGTCCAACTGGATTTCCA. Deletion right flank: TTGGCTTCCAAAGCTTCAAGAGATTGATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3224 |
C. elegans |
+/mT1 II; set-16(ok3661)/mT1 [dpy-10(e128)] III. Show Description
T12D8.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3661 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CAACAGTTCCGTAACGCTCA. External right primer: TTCTGATGGGGCTATTGGAG. Internal left primer: GACGAGATCACGGATCCAAT. Internal right primer: GTTTTTGCACTGGCTGGAAT. Internal WT amplicon: 1224 bp. Deletion size: 706 bp. Deletion left flank: GCTTCCACAGGTCGACGTCGATCCGCCGAA. Deletion right flank: AAAGATGAGGTCGCCTGGAGTATGGAGGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3226 |
C. elegans |
bli-3(gk3069)/szT1 [lon-2(e678)] I; +/szT1 X. Show Description
Apparent homozygous lethal deletion chromosome (gk3069 in F56C11.1) balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and gk3069 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGTGCAAATGAAGGAGCATC. External right primer: CTTCACACCGTTGGACATTG. Internal left primer: TCCACAACTGAACACTCCGA. Internal right primer: TTCAGGAAGCATTCTTTGGG. Internal WT amplicon: 1399 bp. Deletion size: 443 bp. Deletion left flank: CTGAACACTCCGATTTTGGATTGCTGCAAA. Deletion right flank: AGGAAATATACTTTACGGCAACGAACTCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC327 |
C. elegans |
+/nT1 IV; gad-1(ok573)/nT1 V. Show Description
T05H4.14. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok573 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3272 |
C. elegans |
+/szT1 [lon-2(e678)] I; C35C5.6(ok1279)/szT1 X. Show Description
C35C5.6. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1279 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATTCCGATGAGCACGTTAGG. External right primer: GCGAGAAGAGCATTTTGACC. Internal left primer: CCGTCAATCAGAGAAGAGCC. Internal right primer: CCTTCGACAATAAAGGCCAA. Internal WT amplicon: 3388 bp. Deletion size: 1808 bp. Deletion left flank: CTTGCAATATATTTGGGCTACACAATGAGT. Deletion right flank: CTTCATTCCAACCGGAACAATTCATATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3287 |
C. elegans |
C08G9.2(gk3384)/nT1 IV; +/nT1 V. Show Description
C08G9.2. Apparent homozygous lethal deletion chromosome balanced by translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, vulvaless nT1 homozygotes, and gk3384 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCACAAGTTGGTACTGGGAGG. External right primer: CCATGCGAATTTTTGAACTGT. Internal left primer: ACAAGACCGTATGGGCAAAG. Internal right primer: ACCAATTTCATCTTGCCCTG. Internal WT amplicon: 1980 bp. Deletion size: 466 bp. Deletion left flank: GTCTGATCGTAGTTTCCATTTCTACTGCAT. Deletion right flank: GGTTTGATGTACATTCTACACGTCGAAGTG. Insertion Sequence: TTCTACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3310 |
C. elegans |
srgp-1(gk3385)/nT1 IV; +/nT1 V. Show Description
F12F6.5. Apparent homozygous lethal deletion chromosome balanced by translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, vulvaless nT1 homozygotes, and gk3385 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GAAGTCACTTGAAGCATCAGAAAA. External right primer: TCAGAATCAAGCTTCTTTGTTGAG. Internal left primer: TCAAAAACCAATTTCGTTAGAGC. Internal right primer: TGATTTTTATTGCCTTTTTCCAA. Internal WT amplicon: 2179 bp. Deletion size: 980 bp. Deletion left flank: TATGTAGAAGCAACTGGAGAAGAAATTCCA. Deletion right flank: TTCAAAAATAGTTCATTATCATCCGAAGGA. Insertion Sequence: TAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3317 |
C. elegans |
+/II; gly-5(gk3278)/mT1 [dpy-10(e128)] III. Show Description
Apparent homozygous lethal deletion chromosome (gk3278 in Y39E4B.12) balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk3278 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GAAAAGGCAAAATACGACAAGG. External right primer: AATCGCGAAAAATTTCCAGTAA. Internal left primer: CAAAAATGTTGTCGATTTACGAAG. Internal right primer: CTTTTCTTACCAAGCATCGAATTT. Internal WT amplicon: 1049 bp. Deletion size: 581 bp. Deletion left flank: TCTGTACAAAAAAGCATTTTTTCTGCAAAA. Deletion right flank: AATGGAAGGTAAAAATTAAATTTTCGACCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3363 |
C. elegans |
gei-4(gk3508)/sC1 [dpy-1(s2170)] III. Show Description
W07B3.2. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and gk3508 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGGATAATCATGCCAGAAGTG. External right primer: ATCGAGCAGAATTTGTCCATTT. Internal left primer: ACACCTGAATCTGCTGCTGTT. Internal right primer: ACGAATTGAATGAAATCACGC. WT internal amplicon: 2021 bp. Deletion size: approximately 1100 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC339 |
C. elegans |
+/szT1 [lon-2(e678)] I; ref-2(gk178)/szT1 X. Show Description
C47C12.3. Heterozygotes are WT and segregate WT, arrested szT1 aneuploid progeny, Lon-2 males, and homozygous gk178 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|