Search Strains

H04M03.4. Apparent homozygous lethal deletion chromosome balanced by translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, vulvaless nT1 homozygotes, and ok1750 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ACGGAAATTGTGCCGTTAAT. External right primer: TTTTGCGAATTTTTCATCCC. Internal left primer: AATGTTTCAGGAGGCCATTG. Internal right primer: TATCCCCGTGGAATAGTTGG. Internal WT amplicon: 3042 bp. Deletion size: 1376 bp. Deletion left flank: AGAAGTTGCCAAATGAGTGGTTCAAGTTCA. Deletion right flank: TATATGTGCTATATAATTCTCATAATTTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13E6.5. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1828 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATCGAGGAGTGGGATCAATG. External right primer: GCGTTTCACGGATACTTGTG. Internal left primer: CTTTGAAATTTCCCCTGCAA. Internal right primer: AATAACGCCACCTGCAAAAG. Internal WT amplicon: 2983 bp. Deletion size: 1090 bp. Deletion left flank: GATCATCAAGCATTTTTTTGATATCATGTA. Deletion right flank: ATTGTGTAATTTTCAGCATCTTCTTGTTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R144.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1869 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGCCAGATGAGGAAACAACA. External right primer: CTCAGGTGACACCAAAACGA. Internal left primer: TCGAAGATCTTGGCAGAGGT. Internal right primer: ACATACCCCAACTCAGTGGC. Internal WT amplicon: 3130 bp. Deletion size: 1991 bp. Deletion left flank: ATCGAGAAGGCTGTGTATGTGTGTCAACTT. Deletion right flank: AACAGAACGAGCTCTTCGTGAACTCCGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25F2.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1876 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGGAGTATCGCGCATCATA. External right primer: TCCATTGCATCCAAACGTAA. Internal left primer: CCGAATGGCGAGAGATGTAT. Internal right primer: TTTGTTGGCAATGAGTGCAT. Internal WT amplicon: 2539 bp. Deletion size: 1864 bp. Deletion left flank: GACGGATCATGTGGTCATTGCTGAGAAGTT. Deletion right flank: GAATCTGCAGAAGCAGAAGCAACTGCTGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y71H2AM.1. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok1854 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GCACCATCTCCGGGATATAA. External right primer: CCGTAAATTGACACAACCGA. Internal left primer: CGCCAAAACTCATCGAATCT. Internal right primer: CTCTTGAGCTCAGGCTTCGT. Internal WT amplicon: 2882 bp. Deletion size: 1642 bp. Deletion left flank: TCATACGTCGAGCAAGGAGTTGCTCATTGT. Deletion right flank: CAATTTTTTCACTTATTTTTATCTGAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C03G5.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1908 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACGAAGGCAAACTGGTGAC. External right primer: CTACGAGCGGTTCATTTGGT. Internal left primer: AATAGGAGCGGACCTTTGGT. Internal right primer: GCAATTCCGCACGTTTATCT. Internal WT amplicon: 2954 bp. Deletion size: 1211 bp. Deletion left flank: GACGAAGCTCGGCAGTTGAGATGTCTCCCT. Deletion right flank: GCATTACAATTAAAATATTCTGATTAAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02B12.1. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk665 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAGACAGACGAATGCAACGA. External right primer: GTGCCTTCTTTTTCCAACCA. Internal left primer: ACAGAAGAAAGGGCGGAAAT. Internal right primer: CAACTTCCAACTGCTTTGGG. Internal WT amplicon: 2295 bp. Deletion size: 1525 bp. Deletion left flank: GAAGGTACATTAGTGAATAGGAAAATAATA. Deletion right flank: AGACATTGATGCTGTAGAATTGTGAAGATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y92C3B.1, F58B6.3. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok1890 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAAACCCCTCACCTCGACTT. External right primer: AAAAATTGGAAAAATCCGGG. Internal left primer: CGAAGGGAAAATGCAGGATA. Internal right primer: TAAAAATCGGCAGAAATCGG. Internal WT amplicon: 2138 bp. Deletion size: 898 bp. Deletion left flank: AGGATAATTTTTTTTTTGTTGGGAAATTTA. Deletion right flank: TACGGGCTTCGCAGAGCGATTTATCGATTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F41D9.5. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1953 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCTCGTAAGGGTAATTGGCA. External right primer: TCCAAGAAGGAGTGGTCCAG. Internal left primer: TTCATCAACAGCAGTTTGGC. Internal right primer: CAACGTGCATATCCCAACAG. Internal WT amplicon: 3086 bp. Deletion size: 2464 bp. Deletion left flank: GTTTCTGACATGACCTCTTCAGAATTTTCA. Deletion right flank: GAGGAAATCTGTTGATTAAATAATGAGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C02B4.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1965 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATACGACGACCTCAGTTGCC. External right primer: GCACAACTTTTGTCGGGTTT. Internal left primer: GTGTGACCCGTTATTCGCTT. Internal right primer: GCTCAGGACAACTTGCTTCC. Internal WT amplicon: 3370 bp. Deletion size: 1659 bp. Deletion left flank: TGATGCTTCCCCAGGCCTTATATCTACAAA. Deletion right flank: ATGGGGCGATTGGCTGCCGTGCTCTGTATC. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T22B2.4. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1843 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGCAGGTCAATTTCACGGTA. External right primer: CAATGAGGATGTGCAAATGG. Internal left primer: AATGTACGGCCAAGTCCAAG. Internal right primer: TATTGCTGGGACGACAATGA. Internal WT amplicon: 2626 bp. Deletion size: 1803 bp. Deletion left flank: CGCCGAACCAGTAGTTGGTGAGTTTCCTGT. Deletion right flank: CAATGATTTTACTTTTCATTCTATCCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R06A4.10. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1849 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGGTCTTTTGGATGACACCG. External right primer: CCGCCAAATTACCTACCAAA. Internal left primer: TACTGTATCCGGAGCCATCC. Internal right primer: TGGGTGGTTGACCAATTTCT. Internal WT amplicon: 3238 bp. Deletion size: 1398 bp. Deletion left flank: CCATCCACCAGTAGAAAAAACCAATCAGAT. Deletion right flank: GATCAGAATAATACAATCCTAACTGTTTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F14F4.3. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2067 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATCGGCAGGTGAAACAGTTC. External right primer: GATGGGAGCAGATTTTCAGC. Internal left primer: ATCTCATTGCCGATTGGAAC. Internal right primer: GTCCAGTCGTCCCAGTTGTT. Internal WT amplicon: 3301 bp. Deletion size: 1167 bp. Deletion left flank: CATAAAAATAGCACCACTGTTGCAGTCCAA. Deletion right flank: ACTCGTCTTCATTTCCAAAAATTCAGTTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T01G9.6. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2031 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCTCGCAAAATTTCACGTTT. External right primer: TTCGACAGAAAACTGCTGGA. Internal left primer: GTGACGAAGACAGGCACAAA. Internal right primer: TTCACCCAACCTGTACCCAT. Internal WT amplicon: 2149 bp. Deletion size: 966 bp. Deletion left flank: AGTCGTGTTGTTTTGTGCTGCGGCAACGTT. Deletion right flank: TGGAAGCATTGGCTGATTTTCACAGTAGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M142.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk709 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCTTCCCCTCTTCTATTGGC. External right primer: CGACACGCAACACCAATTAC. Internal left primer: AATCCACCGTAGTCACCGAG. Internal right primer: TCAGAGCATGTTTCCCAGTG. Internal WT amplicon: 2427 bp. Deletion size: 1019 bp. Deletion left flank: TAAATTTTTGTAGTTTTTTAGGGATTTTTT. Deletion right flank: TCACTTGTGGAGATGGTCGCCGCATCTCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y71H2AM.3. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2025 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGTCATGTTTTTCCGGTGA. External right primer: TCTCGCTTCACGTTTTTGTG. Internal left primer: TTTTATTCGCATTTCCTCCG. Internal right primer: TCGGCTTTCTCCTCATGTTT. Internal WT amplicon: 2726 bp. Deletion size: 1372 bp. Deletion left flank: CACAAGTGGCTCACCGACTAAAAAATCGAG. Deletion right flank: ACTATTCAATGTCTTCCAGATGATGATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44A6.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2071 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGGACTGGACCTACAGAGGG. External right primer: GGCAGCAACATCTACAGCAA. Internal left primer: TGTGTTGGAATGAAAACGGA. Internal right primer: AGGGACCAGATCAGTTGTGC. Internal WT amplicon: 3077 bp. Deletion size: 2408 bp. Deletion left flank: TACTAAGTCGATTCAATTCATGAATACATT. Deletion right flank: CACAGTCTTTTTACCACGCCTACATCGCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T26G10.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2057 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCACCATCAGCAATATCCA. External right primer: TCCGTTGGACTTTCCAATTC. Internal left primer: TTTTGTCGTCGCTTCTTTCC. Internal right primer: AAGTGTCGTCAGATTGCGTG. Internal WT amplicon: 2101 bp. Deletion size: 1183 bp. Deletion left flank: AGTCGGAAAATTCAAAATCTAACCTAAATT. Deletion right flank: CTCTGAAGACAATTAACCAGTTATTTCAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54E5A.2. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2070 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGTTTCGGTGTTGAGAGCGT. External right primer: TGGTGCATGATTTGTGGATT. Internal left primer: GCTCACAACTTCACGCAGAG. Internal right primer: TAAACACCAAGTGGCACCAA. Internal WT amplicon: 2168 bp. Deletion size: 1739 bp. Deletion left flank: AATTTCACGGGGTATATTTAATTTTTAATT. Deletion right flank: TTTTATCATGATATCTCAAAAGTTGAGTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C48A7.2. Apparent homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2116 homozygotes (arrest stage/phenotype undetermined). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTACGCCGGAAAGACAAAAA. External right primer: AAATCAATGAATGTGGGGGA. Internal left primer: TAAATGACGCCGAATTGTCA. Internal right primer: ATCGAAACTGCGCTGATCTT. Internal WT amplicon: 3253 bp. Deletion size: 1307 bp. Deletion left flank: TTGTTACAATAACTATGCAAATGTAAATAT. Deletion right flank: CCCCAAGATATAGTTTCGATAAGTAAATAC. Insertion Sequence: AT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C07A12.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and gk780 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTGATTATGGGGTCGAATGG. External right primer: TGGAAAGATGGGGCAATTAG. Internal left primer: GGGAGCGAGAGAGAGACAAA. Internal right primer: GCTCCAGTGGGAAATTGAAA. Internal WT amplicon: 2317 bp. Deletion size: 1294 bp. Deletion left flank: AATGCATTGTCCAATCGCTGCTATGTATGC. Deletion right flank: AGAGCCAAAATGACCAACATTATTGACAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F02E8.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2029 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTCACCTCTTTCCCAATCCA. External right primer: AGGTTTTGTGGCTGACGAAT. Internal left primer: CTAAACGACACTCCGCTGGT. Internal right primer: GCCACAGAAATGTGGCTTTT. Internal WT amplicon: 2129 bp. Deletion size: 1155 bp. Deletion left flank: GACTGCAACAAGGAATGGTCTGCTCCAGAA. Deletion right flank: ACTTTAAATACGAGATGAAAAAAGGACTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44A6.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and gk829 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ACCATTCATGCCTACCTTGC. External right primer: GTCATCGCTTCCCAACATCT. Internal left primer: ATCCACTTGCTTTGTCTCCG. Internal right primer: TGGTGAAGTGAGCTCGAGTG. Internal WT amplicon: 2458 bp. Deletion size: 725 bp. Deletion left flank: AGAAATAGACTCCCTAACTTACCACTTGTT. Deletion right flank: CGTGTATTAATCTGCGCTGAATGCCTGCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F56A12.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2137 homozygotes (probably most often early larval or embryonic arrest, but occasional homozygotes are seen that are Dpyish, Unc and arrest as mid-stage larvae). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCGGAAATCATCATCCAAT. External right primer: CAAAAGTCACGCGAATCTCA. Internal left primer: CCCATCCTCACCTCCTAACA. Internal right primer: GCGAAGGAGATTTTGAGCAC. Internal WT amplicon: 3042 bp. Deletion size: 1782 bp. Deletion left flank: TTTTTAAAAACATGTTCAACATGCACATAG. Deletion right flank: GTTTTTTGAAACACTGAAAAAATAAAAACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T22D1.9. Apparent homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2259 homozygotes (arrest stage/phenotype undetermined). Viable WT non-GFP segregants are not homozygotes but rare recombinants. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTTGACCAACACGAACAGA. External right primer: TGACTGCGCCTTTAAACAAA. Internal left primer: TCAAGCTTCCAGGCTTCATT. Internal right primer: TGGTGGCGACTACTCAACAG. Internal WT amplicon: 2938 bp. Deletion size: 1651 bp. Deletion left flank: TATGAACAAGGGAATAGCCAAAACTCGAGG. Deletion right flank: ATGGCTTGTAAAGTGTTCAATTTCAGGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T19A5.2. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk137 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01G8.9. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk816 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. (Note: in this strain hT2[qIs48] occasionally recombines such that the GFP and its associated lethality are lost and the non-GFP hT2 left behind still carries the bli-4 mutation of the original hT2. Such a recombination event results in a viable non-GFP animal that is no longer gk816/hT2[qIs48] but is gk816/hT2.) External left primer: GCCATCACTTTCATCGGATT. External right primer: AATAGACGGCACGTGGAAAC. Internal left primer: ATTCGTTGTTGATAAGCCGC. Internal right primer: ATGACCGATGATGATGACGA. Internal WT amplicon: 1843 bp. Deletion size: 1268 bp. Deletion left flank: AGACATAGACGTCATGCGAAAAATAATATA. Deletion right flank: TCTATATATTCTCCGCGTGGTGGGCTATTT. Insertion Sequence: TATAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F52E10.5. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2180 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTGACACATTCCCCACTG. External right primer: GAGCCGTGTAGCTCGGTTAG. Internal left primer: GGTCATAATGAAATGGCGCT. Internal right primer: CTGGAAATCGTGTGCTCAAA. Internal WT amplicon: 2668 bp. Deletion size: 1567 bp. Deletion left flank: CCGGGTGGAGGATATAGTCGGATGGGAAAG. Deletion right flank: ATCCAGTACTCTTTCCAAATCTCGATTGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y87G2A.10. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2278 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAAGACGTTGTGTCTTCCCG. External right primer: CTACAAACCGAGCTGAGCCT. Internal left primer: CCTCACAATTTTGAAACTGCTC. Internal right primer: AATTTCGAGTTTTCGCTTGAA. Internal WT amplicon: 3080 bp. Deletion size: approximately 1600 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F58A3.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2314 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTTGCGCGTGTTTAGTTCTG. External right primer: CAACGCTTCTAAAGCCATCC. Internal left primer: TTTTTGCAGGGTCTTTGGTC. Internal right primer: ACAAGATGGCGTTGTGTCAA. Internal WT amplicon: 2895 bp. Deletion size: 1208 bp. Deletion left flank: GTAGTGCTCGGTCCGGCGGATACGAATTCA. Deletion right flank: TTTTAATTGCGTTTCAGGAAATCGCAGTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F49E12.6. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk835 homozygotes (arrest stage/phenotype undetermined). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGCTCTGGGAACTCTTCGAT. External right primer: GGAGTGGTCGGTGTTGAAGT. Internal left primer: TATTTGGTGACGTGGCATTG. Internal right primer: CCACGTGGTGATGACAACTC. Internal WT amplicon: 2404 bp. Deletion size: 812 bp. Deletion left flank: GGCATAGTTATGGTTTTTCTTATTCTATGT. Deletion right flank: TTTGGGATTGCTCTGTCAAAGATTTCTGAT. Insertion Sequence: TTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H06I04.2. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2277 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGACAACTCCTTGCCTCACC. External right primer: ATTCCCCGCCATTTATTACC. Internal left primer: CAAACAATCCCAAATTCTCG. Internal right primer: AGCTACAGTAACCCGCGAAA. Internal WT amplicon: 3080 bp. Deletion size: 1808 bp. Deletion left flank: AAAAAAAATTTCTAAATTTATTCCCAATTT. Deletion right flank: TCAAAAAATCAGGGGTTCGTTGTGAAAAAT. Insertion Sequence: TCTTCTAAATTTATTCCCAATTTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T08B1.2. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk136 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54F10AM.10. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2313 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATTGGTTGGCGACTTTTCAC. External right primer: AGGGGGAACTGTCGGTTAGT. Internal left primer: TACAAATCCCCGTCCCAATA. Internal right primer: AGAAGTCGAGGTGGCAGGTA. Internal WT amplicon: 3304 bp. Deletion size: 2261 bp. Deletion left flank: GCGATAATTTGTTGTTTTTACTGAAAATTT. Deletion right flank: TCGAGGGTGGCTACTGTATTCTCGCGGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W04G3.8. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2351 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACCTGACCGAATGGAAGTG. External right primer: TGCCTGTGTGTTCCATGTTT. Internal left primer: CAATGCGAATTTGTATTTCCG. Internal right primer: TGAGTAATTAGGGCACGGTGT. Internal WT amplicon: 3060 bp. Deletion size: 1878 bp. Deletion left flank: CAAAACCAGCTTATCAAATTCTTTGGACTT. Deletion right flank: ACAACGCATTGAACCCCACTTAAAAAGGGT. Insertion Sequence: C. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T14F9.4. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1941 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GCGTGAGCAGTATGCCACTA. External right primer: GCCTGGGTTCAACATAGCAT. Internal left primer: AATTTAGGGCTTCCTTCCCA. Internal right primer: GCTGAATGGTGGCTCAACTT. Internal WT amplicon: 1610 bp. Deletion size: 779 bp. Deletion left flank: CTAGCTTTTGAGAGTGTCTAAGGGAATTGT. Deletion right flank: AAACGAATGATGAAGTTTGAAGTTGATGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11H8.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2300 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCAGCATTTCCTGTAGCACG. External right primer: CAAGATAATCAGGCGAAGGG. Internal left primer: CGGCTTCCTTTCTTGTTGAG. Internal right primer: CGGAATGCAAGCAGGATATT. Internal WT amplicon: 3243 bp. Deletion size: 826 bp. Deletion left flank: TTCAAAAATGTTCGGAATCCTTCAGATGCT. Deletion right flank: GCGGGGGTCCTCCGGTGATTGGAGGAAGAC. Insertion Sequence: TCGGAATCCTTCAGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K03D10.3. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2429 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACTGTTTGAACTCACCCCG. External right primer: AAATTTCCGGTTTTCTGGCT. Internal left primer: TAAAAATTGGGTGAGGCTCG. Internal right primer: TACGGGAAAAACTGCCAAAA. Internal WT amplicon: 3157 bp. Deletion size: 2168 bp. Deletion left flank: AACTGTAATTTACGGTGTTTTATATCGAAT. Deletion right flank: GCATTTAAATCGATTTTTCCCATAAAATCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04H5.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2475 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTGCCTACGTGGCAAGTACA. External right primer: AAAATGACTCACGAAACGGG. Internal left primer: TGCACGTGGCAAGGTATCTA. Internal right primer: TGCAAAAATGTTGGAGAGCA. Internal WT amplicon: 3309 bp. Deletion size: 1504 bp. Deletion left flank: TTGCAAATTCGGCAGAAGTTGCAGTGTATG. Deletion right flank: TTCAAAATGAACTTCCATACACTTACCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K07D8.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2321 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGGATGGCAGGAATTGTTT. External right primer: GCGGTAACGGACTTTGTCAT. Internal left primer: GAAATGAGCACGGGGATTTA. Internal right primer: GCTTCTTCATGTGACTGGCA. Internal WT amplicon: 2913 bp. Deletion size: 1384 bp. Deletion left flank: TATTTTATTTGGTTTTACCTGACTCTGACT. Deletion right flank: AACAGTTTACTTAATAATCAGCTTTATTGA. Insertion Sequence: ACAGTTTACTTAATAATCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F52E4.7. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation, and homozygous for unlinked pharyngeal GFP insertion mIs12 (artifact of strain construction). Balanced lethal heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2238 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain.External left primer: CAATCTTCGAGCCTGGGTAA. External right primer: TACCTTCCAGTCCAGATGCC. Internal left primer: TGAAATGGCGATTTTGATGA. Internal right primer: CATGATATGGCGATGCAAAG. Internal WT amplicon: 2918 bp. Deletion size: 1120 bp. Deletion left flank: TTTCTCCATACTACGTCCTCCGAGACTTGA. Deletion right flank: AATGAAACGATTTCCTCGTTGAGACGTTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C03F11.3. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2598 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATCGACAAGGCAATGAGACC. External right primer: TGGGAGCTTTAATCGAAGGA. Internal left primer: GCCAAGTCCAACAGCTATCC. Internal right primer: CAATTGCTCTTTTCGGGCTA. Internal WT amplicon: 1231 bp. Deletion size: 302 bp. Deletion left flank: GTAAATCCCCATTGCAAACAAAAAAAGTGT. Deletion right flank: CAGTACGTTTTATTAGCGTAGGGCCACCTA. Insertion Sequence: ACCAACGCCGAGTTCGGGTCCTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48G10A.3. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2508 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTGGATGGTTTTCGCAGTTT. External right primer: TGACATGCAGCCTCTAATGG. Internal left primer: ATTCTGCGTCTCCTGCATCT. Internal right primer: AAAAGTGAACACGGCCTTTG. Internal WT amplicon: 2246 bp. Deletion size: 1628 bp. Deletion left flank: AAAAGAGCATCATGCTCTCCGTCACAGCGT. Deletion right flank: TTTTAAAAAAGTTTTGGTTTTTTTTTTAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F10C5.1. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2476 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACTTTCGCCGTTTGATGTC. External right primer: CCGAAAATTAGCCGATTTGA. Internal left primer: TGATAAATGGTGTGCTCCGA. Internal right primer: GATTTATCCGTCAGCCGAAA. Internal WT amplicon: 2623 bp. Deletion size: 1324 bp. Deletion left flank: CTAAGGCCATAAAAATCAACAAAATCTAAA. Deletion right flank: TATTTAGCAGACCAAAGTTGGGTATCCAAT. Insertion Sequence: GAAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y63D3A.5. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2290 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGCTCCGGATAAACTTGGGT. External right primer: TATTCCCTTCCCACCAATCA. Internal left primer: TTCCAGATGGTGCATTCAAA. Internal right primer: AGACAGGAGCCCGAGATTTT. Internal WT amplicon: 2440 bp. Deletion size: 1264 bp. Deletion left flank: AGCAGATTAAGGTAAGGAGGATTTTGAGCG. Deletion right flank: CCACCACCGCAGGGAGCTCCCCAGCAAGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04H5.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2708 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATCTTCGCCTGCAAATCAC. External right primer: TTCATGCCGTACCTGTTCAA. Internal left primer: TCTTCGATCCCAGTGCTTTC. Internal right primer: AAGGAGCAAAACTTCGATGG. Internal WT amplicon: 3202 bp. Deletion size: 2453 bp. Deletion left flank: ATACCAAAATATCGCCGGGAAGTGGCTGGG. Deletion right flank: GCGAATAAAAGTCGAAAAAAAAATGTTTTG. Insertion Sequence: ATTTTTTTTCGTTTTTTTTTGGGTTTATTCGAAGTATTGATTAAAATTTAAGAGCGATC GATTTTTTTCTTAATTAAAAACAAAAATCCTGAATGTTTGGTTTTTTTGCTGTTTTTGT AAATGTTCTAAAAATTACCTATAACTAGCCAAATCGGGTTCGTTGAGAAACTCTCTGAG CAGCATTCCGTCTGTCATGTATTTGAGGACAGTCTTCTCCGATGTGCAATCCTCGAAAC GAATACTGTAGCCGACCTGGAAAATGGAAGCGTTTCGAAAGAAAAATCGGAATCTGTTT TCCTCGTTTTTTTACAAGTTTAAAAATTTTTAGAAGCGGCAAAGAATTGCCCAAATTTT TTTAACTTCCAGTTTTTTTTTCTAAATTTTGGAATTTTCCGACTAGAATGAAACTTAGT TTATTTTCGCCAATTTCCAAAAACCACCCAACCTGAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y82E9BR.16. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2740 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAAACCTGGGGATTTTAGCG. External right primer: TATCACCACATTTCCCGTCA. Internal left primer: AATTTGAAAATTTTTGAGGTTTCAT. Internal right primer: TTTCGCGGAAATATTGAACTTT. Internal WT amplicon: 3097 bp. Deletion size: 1978 bp. Deletion left flank: TTTTTTCAAATCGTTGCTAAATTTGAATTT. Deletion right flank: GGGCTTTTTCAGCAATTTCCGGGTAATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F33H1.4. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk953 homozygotes (arrest stage/phenotype undetermined). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AGGCCATTCCTTGAAAGGTT. External right primer: GCTAGTAGTCGCTGATCCCG. Internal left primer: GAGGTACCCGTAGATCGCAA. Internal right primer: CGAAATCCGTTCTCCATCAT. Internal WT amplicon: 2555 bp. Deletion size: 836 bp. Deletion left flank: TTGCTCCAAATGCGGGAATTGAAGATAATA. Deletion right flank: GAAGATCGTATTGGTAGATCTGATTTAATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C26E6.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2893 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGAAGCATGGCAAGAAGCAT. External right primer: GCTTTCTTTTGATCACCCCA. Internal left primer: ATGTGCAGCGAATTGTTGAG. Internal right primer: GACGCAGACATCAAGAGCAA. Internal WT amplicon: 1187 bp. Deletion size: 331 bp. Deletion left flank: GATTATGATTGTGTTCCGAGCGCTGGGATT. Deletion right flank: GGAAACAAAAGACTGGATTTAGCCGGACCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H19M22.3. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2827 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATCCGTGACGCTTAAATGG. External right primer: ATAATTCAGTGCCCGAGAGC. Internal left primer: ATCTCCGACTACACCAGCGA. Internal right primer: AGCGTCCGTTGACTTGAGTT. Internal WT amplicon: 1135 bp. Deletion size: 538 bp. Deletion left flank: AGAAAAAAATCTAGCAGATTGCAAAATCTA. Deletion right flank: AGTGTGCAGTGAGCAGCTGCTGCGACAAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807