| GS1214 |
C. elegans |
sel-12(ar171) unc-1(e538) X. Show Description
Egl. Unc. Do not distribute this strain; other labs should request it from the CGC.
|
|
| IE53215 |
C. elegans |
ttTi53215 V. Show Description
Homozygous.
|
|
| RG3030 |
C. elegans |
C46F4.3(ve530[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 794 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATCTTACTTTCCGTTTCTGCAAAACAAGTG ; Right flanking sequence: GGAGGAGTCTGCAGACCGTCGACAAAGTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3031 |
C. elegans |
F53C11.9(ve531[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 349 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aattctcattgagaacatttcaacacacaa ; Right flanking sequence: CAAGGATTTGTTGTTGATTCAAATACCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3032 |
C. elegans |
igeg-1(ve532[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2773 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATTTGGTCTTTCGATCCAATAACGTTGAA ; Right flanking sequence: AACGGAACATCAGATTCAAAACTGCTCGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3033 |
C. elegans |
igeg-2(ve533[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1425 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGTTAATAGTTGTCGTCGAGTACTTGGAGT ; Right flanking sequence: TGTGGTTCCCGTGTGTGTTCCTTcttaaat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3034 |
C. elegans |
+/nT1[umnIs49] IV; C37C3.7(ve534[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste, Mig. Deletion of 1217 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste Mig GFP+ non-mKate2 (ve534 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GAAGTCGATGCCGTTCTGCAGTATCCTTCA ; Right flanking sequence: TACAATGACAAATCCCTCCAGCATAGATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3035 |
C. elegans |
nas-17(ve535[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1433 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATCACTTCGACATGTTTCTTCGACCATCT ; Right flanking sequence: TACGGAAGCAGCAAGTTGACAATTCATTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3036 |
C. elegans |
irg-7(ve536[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 5265 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ccTTAGTTGTTGATACAGTAGACACCTCCA ; Right flanking sequence: GCTACAATTGTAACGTAGTCAACGCTAAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3037 |
C. elegans |
Y65B4BL.6(ve537[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1682 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggctataaaacgacggaaaaagaaataaaa ; Right flanking sequence: ggcggtgaagccgtgtgtgtgtgtgtggct. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3038 |
C. elegans |
C26D10.3(ve538[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1301 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tctcgagtaattcgtatcctgcgaataaat ; Right flanking sequence: CAAGGAGAAGTGTGTGGAAGAGCGATGGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3039 |
C. elegans |
spe-36(ve539[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49] IV; +/nT1 V. Show Description
F40F11.4. umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste, lays only oocytes. Deletion of 2632 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste GFP+ non-mKate2 (ve539 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcacaaaaactcacAAATAACTTTGTACCG ; Right flanking sequence: ACGCAAGAGCTATGAAGAACAGAATACATA. sgRNA #1: acAAATAACTTTGTACCGGG; sgRNA #2: CTTCATAGCTCTTGCGTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| SP1022 |
C. elegans |
mnDp65 (X;I); unc-1(e538) X. Show Description
WT.
|
|
| SP1023 |
C. elegans |
mnDp68 (X;f); unc-1(e538) X. Show Description
Strain throws WT and Uncs. Maintain by picking WT.
|
|
| SP1024 |
C. elegans |
mnDp70 (X;V); unc-1(e538) X. Show Description
WT strain.
|
|
| SP1025 |
C. elegans |
mnDp69 (X;I); unc-1(e538) X. Show Description
WT strain.
|
|
| SP1027 |
C. elegans |
mnDp66 (X;I); unc-1(e538) X. Show Description
WT strain.
|
|
| SP1031 |
C. elegans |
mnDp67 (X;I); unc-1(e538) X. Show Description
WT strain.
|
|
| SP1053 |
C. elegans |
mnDp71 (X;f); unc-1(e538) X. Show Description
Strain throws WT and Uncs. Maintain by picking WT.
|
|
| SP1085 |
C. elegans |
mnDp73 (X;f); unc-1(e538) X. Show Description
Strain throws WT and Uncs.
|
|
| SP934 |
C. elegans |
unc-1(e538) dpy-3(e27) X. Show Description
DpyUnc.
|
|
| SP940 |
C. elegans |
unc-52(e444) II; unc-1(e538) X; mnDp11 (II;X;f). Show Description
Maintain strain by picking WT. Throws WT and Unc.
|
|
| SP965 |
C. elegans |
mnDp63 (X;I); unc-1(e538) X. Show Description
WT phenotype.
|
|