Search Strains

More Fields
Strain Species Genotype Add
VC1895 C. elegans +/mT1 II; cyk-1(ok2300)/mT1 [dpy-10(e128)] III. Show Description
F11H8.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2300 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCAGCATTTCCTGTAGCACG. External right primer: CAAGATAATCAGGCGAAGGG. Internal left primer: CGGCTTCCTTTCTTGTTGAG. Internal right primer: CGGAATGCAAGCAGGATATT. Internal WT amplicon: 3243 bp. Deletion size: 826 bp. Deletion left flank: TTCAAAAATGTTCGGAATCCTTCAGATGCT. Deletion right flank: GCGGGGGTCCTCCGGTGATTGGAGGAAGAC. Insertion Sequence: TCGGAATCCTTCAGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1896 C. elegans ckb-3(ok2310) III. Show Description
B0285.10. External left primer: ACTATTCGTTGGCAACTCGC. External right primer: TGAACCGAAGACGAGACTCC. Internal left primer: GGACTCCGTAGCTGTTCTACAAA. Internal right primer: GGCCCGGACTCAGTAAAGTC. Internal WT amplicon: 3214 bp. Deletion size: 2055 bp. Deletion left flank: ATTAACATTTTGAGCTATTGGCAAAATAAA. Deletion right flank: CTTCCAAACTAAATTTGTCGAAACAAAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1897 C. elegans C32F10.8(tm2997) I. Show Description
C32F10.8. External left primer: GCATTCCGCATTCTCCCATG. External right primer: GCATGCGAACCGTACAAGCA. Internal left primer: CCCATGTATCCTTTGGATAC. Internal right primer: TTCCGGACTCGTCACAAGTC. Internal WT amplicon: 1307 bp. Deletion size: 594 bp. Deletion left flank: TAACTGCTTAGGAAAAAAAGCTCACTTATT. Deletion right flank: CATGGAATTCCTCCATCACGTCTCTTAATA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1898 C. elegans Y66D12A.24&tin-10(ok2400) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y66D12A.22, Y66D12A.24. Homozygous lethal or sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2400 homozygotes (late larval arrest or sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGCTCACTTGACACTTTCG. External right primer: TGGGGAAAATCGAAAACTTG. Internal left primer: CTGTGCAATTTGTGATTGCC. Internal right primer: ATATGTACCGCCGAATGACC. Internal WT amplicon: 2686 bp. Deletion size: 1690 bp. Deletion left flank: TTCATTTTGGCTAATTTCTCAGTAAAAATT. Deletion right flank: TTCGATTTAAAAAAAATCGATTTTTTTCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1900 C. elegans T20H4.2(ok2547) III. Show Description
T20H4.2. External left primer: AGATGGGAGCCAAGACGTTA. External right primer: GACGTTGCCTTCGACATCTT. Internal left primer: TCATGCACATACAATGCCAA. Internal right primer: CTACCAAGTCACGCCCACTT. Internal WT amplicon: 2220 bp. Deletion size: 1394 bp. Deletion left flank: GGGGAATGATGGAAAGAACATTTACACTTT. Deletion right flank: ATGGGGTTAGTAATTCACCATTCGAATCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1902 C. elegans lgc-4(ok2567) X. Show Description
F18G5.4. External left primer: TATTCCATGATGGCGTCGTA. External right primer: CATGGTTGAGTGCAATGGTC. Internal left primer: TCAGGATCTGATGAATCCCC. Internal right primer: GCAGCGCTATCCGAGAATAC. Internal WT amplicon: 2935 bp. Deletion size: 2383 bp. Deletion left flank: ACTTGTAAAAATATGAAACGTATTTCAAAA. Deletion right flank: GCTATTTTTTAATCAGTCGCCTTCATTACA. Insertion Sequence: GGTGGTACTGACCAGAATTGCAGATCTACCAACGAGGCTATACGAATTGCAGGATTTGA TAACTTTGCTGATCAGCTCCAAGAATCCAATGGCGTTTTCGAAGCATGCCCAGAGGCCC ATTCAGAACAAGGAAATGAGAGTGAAGATTTTAAAGATTTGATCAATAGTGAAACTGAG TGCAACATTGAAGACGTTGTTCTCCCGACAGTACACGTTTCTACGGATTCTGAAGAAAT CATTTCGGGCGATGTGATTATGAATGGTTAGTAGATTGTTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1904 C. elegans hlh-34(gk1031) V. Show Description
T01D3.2. External left primer: GTGAAGCCGAAGGATCATGT. External right primer: CGTCTTTGCTTTCTTTTCCG. Internal left primer: GAAGAACTTTGCATCGAGGG. Internal right primer: TGTCCAACAATTTCCAACGA. Internal WT amplicon: 1737 bp. Deletion size: 163 bp. Deletion left flank: TAAAAAACAGAAAAAAAATTAAAAATATAT. Deletion right flank: TTAAATCAAAAACTTAAAAGTTACCGAGTT. Insertion Sequence: TATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1905 C. elegans F21G4.5(gk1035) X. Show Description
F21G4.5. External left primer: TTGATGGAACTTTCATGGCA. External right primer: ATGATCTGAGATGAACGGGG. Internal left primer: CCTCTAAATGCCGACGTTGT. Internal right primer: TCCTGATCAATTGCAGCATC. Internal WT amplicon: 1653 bp. Deletion size: 444 bp. Deletion left flank: TTGCAGGTACATTTTCCTTGGTGAACATAA. Deletion right flank: ACTTTTTTCCATGTCTCCCACAACGTAAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1906 C. elegans ceh-45(gk1015) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZK993.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1015 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAATGGAGAGACGGGTGTGT. External right primer: TTGAAAATTGTGAAGCTGCG. Internal left primer: GGCGCCAGAGTTTGATCTAC. Internal right primer: AGGTTGATGTGGACGGAGAG. Internal WT amplicon: 1907 bp. Deletion size: 1113 bp. Deletion left flank: CAAAATCTTGGTAGTCTAGAAAACCCCAAT. Deletion right flank: CATGGTGTCCTAGGAATATTTTTAAAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1907 C. elegans Y97E10AR.7&rpb-9(gk1044) V/nT1 [qIs51] (IV;V). Show Description
Y97E10AR.5, Y97E10AR.7. Homozygous semi-sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk1044 homozygotes (often sterile or nearly sterile, can be maintained). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTATGAAGCTTAGCGCGGAC. External right primer: GACCATTGACACCTCGACCT. Internal left primer: TGCCAGAAGCATTGTACGAG. Internal right primer: GGATGGGTTAACTGGGATGA. Internal WT amplicon: 1933 bp. Deletion size: 931 bp. Deletion left flank: TAGACTGATTATGAGCATGTTTTAAAAAAT. Deletion right flank: TTTTGTTCCAACATTTTTAGTTTAAAATTA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1908 C. elegans mbk-2(ok2235) IV/nT1 [qIs51] (IV;V). Show Description
F49E11.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2235 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGAGCCGCTCAACACAGTT. External right primer: CGTCGGGCAATAGTAGAGGA. Internal left primer: CGTACAAACATATTGCCCCC. Internal right primer: ACTCACACAAACTGGGGAGG. Internal WT amplicon: 3315 bp. Deletion size: 2275 bp. Deletion left flank: TAGTAATTTTTTTAAGCCAAAAGCTCCTTC. Deletion right flank: TCAAGACCGGATACAGTAATTTTGACGCAA. Insertion Sequence: AGCTCCTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1909 C. elegans flp-1(ok2505) IV/nT1 [qIs51] (IV;V). Show Description
F23B2.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2505 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGTGTCCCGTTTTGGATGT. External right primer: AGCGTCCGAATCTGAAGAAA. Internal left primer: CGGTACTTGCAAAGAAGGCT. Internal right primer: CTGCAGATCGTTTTCCGAAT. Internal WT amplicon: 1194 bp. Deletion size: 475 bp. Deletion left flank: GTATACTATTCATTTAAAAAATATTGCCTA. Deletion right flank: TTTCTGATAAAAAAGAGCACAACTTGGTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1910 C. elegans ncl-1(ok2555) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZK112.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2555 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCGCCAATATGGGACTCTC. External right primer: GGATGATACGGCTTTGTGCT. Internal left primer: AGCCATTCCTGTTCCAAATG. Internal right primer: GATTGGACTTCCTCCGTGAA. Internal WT amplicon: 3295 bp. Deletion size: 1644 bp. Deletion left flank: AACAAATGCTCAAAATGGAGCAATTGATTG. Deletion right flank: TTCTCTCGTAGATTGATGTCCTTCGCGTCG. Insertion Sequence: AATTCTCAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1911 C. elegans C01B12.2(gk1032) II. Show Description
C01B12.2. External left primer: AGACGCCATGATTTTCAACC. External right primer: AACCGTAATGGGACAGCTTG. Internal left primer: GAACCTGCGGTTCAAACAAT. Internal right primer: AGGGAGTGAGCGAGAAACAA. Internal WT amplicon: 2259 bp. Deletion size: 561 bp. Deletion left flank: AAACGTGGTTTTGCCCGAGTTCTCTGAAAC. Deletion right flank: AAGCAATTTACTCAAATTATTTCAGTTAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1914 C. elegans C47G2.3(ok2557)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C47G2.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2557 homozygotes (mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAATCCGTCTGACTCCTCGT. External right primer: GCTGAAAATGAGGTTTGGGA. Internal left primer: GTTGCAAACCTGGGTGGTAG. Internal right primer: GTACTCCTCCCGGACAATGA. Internal WT amplicon: 2124 bp. Deletion size: 1307 bp. Deletion left flank: TTAGGGTTAGCTGGAAAATTTTTTGATTAA. Deletion right flank: CCGTTTTTGGGATCAATTGGTCTGCTATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1915 C. elegans klp-18(ok2519) IV/nT1 [qIs51] (IV;V). Show Description
C06G3.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2519 homozygotes (sterile, lays eggs that don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTTAAACTAGCGATGCCCG. External right primer: GAATTCCGTCCGAACCTTTT. Internal left primer: TCTTCAATCATTCACCGCTTT. Internal right primer: CGTCAACCTCTTGGCGTAGT. Internal WT amplicon: 1183 bp. Deletion size: 556 bp. Deletion left flank: TATGAGCTCCATCATATCTTTGATAGCTCT. Deletion right flank: GTCAAGGAAAGGTCATCTATCCTGAACCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC192 C. elegans tag-18(gk108) X. Show Description
T14G12.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1923 C. elegans unc-22(gk3071) IV. Show Description
unc-22 twitcher. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk3071), it is homozygous for 323 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
VC1924 C. elegans unc-22(gk965) IV. Show Description
Unc-22 twitcher. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk965), it is homozygous for 546 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
VC1925 C. elegans fkh-9(ok1709) X. Show Description
K03C7.2. External left primer: CGAGCTGGGCTAGTGGATAG. External right primer: GCGTTTAACTTTGAGGCAGG. Internal left primer: GCATGTGCAAACTAGGAGCA. Internal right primer: ACGGGGTTTGAGTTGAGTTG. Internal WT amplicon: 3077 bp. Deletion size: 1054 bp. Deletion left flank: AGTTCATTTTGCTGGTTGTTTGTTGCATTG. Deletion right flank: TCATACTGTAGTTGGCAAATATTGAAAGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1927 C. elegans fib-1(ok2527) V/nT1 [qIs51] (IV;V). Show Description
T01C3.7. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2527 homozygotes (early- to mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTTCCGACGAGGAGAAGTG. External right primer: GCTTCCTCGTTATTTGCAGC. Internal left primer: AAGGTCTGAACCGATTGCAC. Internal right primer: TGCTACATATGCCGATTCCA. Internal WT amplicon: 2241 bp. Deletion size: 1271 bp. Deletion left flank: GGCAAGGTTGAGAACCAAGTAAAGATAAAA. Deletion right flank: AAAAATCCTGAAATTCAGTTTACCTCCGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1928 C. elegans Y62E10A.17(gk902) IV/nT1 [qIs51] (IV;V). Show Description
Y62E10A.17. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk902 homozygotes (mostly sterile; eggs sometimes hatch but larvae are abnormal and arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGATTCAGTTGGCGTCTCTG. External right primer: TCTCGTCGTCTCATCCCTCT. Internal left primer: AACCCGTTGAGACACGATTC. Internal right primer: CCATTCCATTACTTGGCACA. Internal WT amplicon: 2267 bp. Deletion size: 1096 bp. Deletion left flank: TGCTGACATACATTCTCTGAAATATTTGGA. Deletion right flank: TTTTTCTGTGCCGCACTTTGGTTTTTTTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC193 C. elegans him-6(ok412) IV. Show Description
T04A11.6. Him. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1930 C. elegans mrps-30(ok2469) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
B0511.8. Homozygous lethal or sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2469 homozygotes (late larval arrest or sterile adult, Unc, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCAAATGCCTATCGAGACC. External right primer: CCCGAATCTCCTAATGCTCA. Internal left primer: AGCATTTTTCTGCGTCCCTA. Internal right primer: ACACGCCCTGCTACTGATCT. Internal WT amplicon: 2582 bp. Deletion size: 1317 bp. Deletion left flank: GAACACTCAAATATTGTCCATTTTTATCAC. Deletion right flank: GTGTGTCTTCATCAGAAAAGTTGATTCCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1931 C. elegans K03D10.3(ok2429)/hIn1 [unc-101(sy241)] I. Show Description
K03D10.3. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2429 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACTGTTTGAACTCACCCCG. External right primer: AAATTTCCGGTTTTCTGGCT. Internal left primer: TAAAAATTGGGTGAGGCTCG. Internal right primer: TACGGGAAAAACTGCCAAAA. Internal WT amplicon: 3157 bp. Deletion size: 2168 bp. Deletion left flank: AACTGTAATTTACGGTGTTTTATATCGAAT. Deletion right flank: GCATTTAAATCGATTTTTCCCATAAAATCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1932 C. elegans T07A5.5&unc-69(ok2448) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T07A5.6, T07A5.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2448 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACGTGTAACCACTTCTCGCC. External right primer: CTTCATCGATCGGCTTTTGT. Internal left primer: CGGCTGTGAACTCATGACATA. Internal right primer: ATTCAAAGCTCGAGCCAAAA. Internal WT amplicon: 2903 bp. Deletion size: 1464 bp. Deletion left flank: GAGCATGAGCATCGCGATTCCAAGAATGTT. Deletion right flank: ATATTTAGTGTAGTAAAACTGTTACGAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1934 C. elegans C47A4.2(ok2161) IV. Show Description
C47A4.2. External left primer: GGGCCAAACTTTCAACAAAA. External right primer: CGAATTACGCAGGGAACAAT. Internal left primer: TAGCTCCGATGAGCACAATG. Internal right primer: GGACCAGGCTGCAAAAATAA. Internal WT amplicon: 3359 bp. Deletion size: 1566 bp. Deletion left flank: AGAACATACCTTTTGAGTATCCGAGAAATT. Deletion right flank: TTTCTCTGTGCACAAATTTGTTTTAAGTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1936 C. elegans madf-9(gk3057) IV. Show Description
madf-9. Homozygous viable deletion, detectable by nested PCR. External left primer: AACAAAACGCATAACCTCCG. External right primer: TCGGCCAAACTTCATTTTTC. Internal left primer: AAAGAGAGAAGAGGGAGCCG. Internal right primer: GGCCAAATCTTTGTGGTTTG. Internal WT amplicon: 1269 bp. Deletion size: 784 bp. Deletion left flank: CCTCCCAACCGCACACATACTACCAACGAT. Deletion right flank: TTAAATTGAGAAATGAAAAAAAAGGTCACG. Validation: gk3057 confirmed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1937 C. elegans elpc-3(ok2452) V. Show Description
ZK863.3. External left primer: TCCTTACCAACGGTCGAAAC. External right primer: CACTGGTCATCTTGAAAGCG. Internal left primer: TTGAAATTTCCGGCTAATCG. Internal right primer: ACTTGAATCGGCTGAAATGC. Internal WT amplicon: 2431 bp. Deletion size: 1504 bp. Deletion left flank: CGGTAGTACTCTCGAGTTCCAACGCCCGAG. Deletion right flank: GACGGAACTCCAGCGATAATGTCAACGAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1939 C. elegans aka-1(ok2520) II. Show Description
D1022.7. External left primer: GCCTTTTGGAAGATGGTCAA. External right primer: CCGATGAAGGAAATCCAGAA. Internal left primer: TTAATGGGATGCGGAAAGAG. Internal right primer: GCAGAATTACGGATGGAGGA. Internal WT amplicon: 3291 bp. Deletion size: 1311 bp. Deletion left flank: ACAAAAATATCAATGTTACTTACCATTGAA. Deletion right flank: AAAAATTTGTACAGTGCAATTCAAATTTTT. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC194 C. elegans cua-1(gk107) III. Show Description
Y76A2A.2. Slow-growing, otherwise superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1942 C. elegans F38H4.10(ok2146) IV/nT1 [qIs51] (IV;V). Show Description
F38H4.10. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2146 homozygotes (grotty, mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTCACCACTTCCCGTCTTC. External right primer: CGCATTTTCAGAATTTGGTG. Internal left primer: CAAAATGCGAATGGACAACA. Internal right primer: GGGAATCACAGAATTGGGAA. Internal WT amplicon: 2120 bp. Deletion size: 934 bp. Deletion left flank: ATTCTTTGAATGACTACTGTAGCGCCTGTG. Deletion right flank: GAAGAAACTGAACCATTACGGGAAATCATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1944 C. elegans unc-29(ok2450) I. Show Description
T08G11.5. External left primer: GCGTTACAGAAGTCTGCCCT. External right primer: TGACGTCTCCAGTCCCTCTT. Internal left primer: TGTTATTTGATTCACCCGCA. Internal right primer: TTGACGGGCGGTTAATATGT. Internal WT amplicon: 3194 bp. Deletion size: 1480 bp. Deletion left flank: CGATGAGTTCTTGGTCCTCGGAAATATACA. Deletion right flank: AACATTTGTATGCATAACTTGATCTTTCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1945 C. elegans H08M01.1(ok2518) IV. Show Description
H08M01.1. External left primer: GCCTAGGATTCAGGTGGGAT. External right primer: TCATTGTGTGAACGAACGGT. Internal left primer: TGTTTCATGGGTTGGGAAAT. Internal right primer: TGATTGGGCATTCGAAAAAT. Internal WT amplicon: 3201 bp. Deletion size: 1630 bp. Deletion left flank: AAACTTTTTCGCAGCAATGACTTTTGGGGC. Deletion right flank: TCTGTGTTGGTGGATTTGGTCGCGCATCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1946 C. elegans pbs-6&cids-1(ok2511) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C02F5.4, C02F5.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2511 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAGCGGTACTTGTGG. External right primer: CTTTCCTGCATCAAGCATCA. Internal left primer: TTTCTTCAATTGGAGGACATCT. Internal right primer: ATTCCAGGAAGATCGAGCAA. Internal WT amplicon: 2526 bp. Deletion size: 1604 bp. Deletion left flank: AATACTGGCTTACAAAATTTGAATCTTCTC. Deletion right flank: GAAGATCGAATCAAGGCAGATTTGTTAGAG. Insertion Sequence: GAATCAAGGCAGATTTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1947 C. elegans nuo-4(ok2533) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K04G7.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2533 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAACCCAAACGTGGCAATA. External right primer: TTGTTAAGACCATCATGCCG. Internal left primer: AAAAGTGTGCGTGGGGTAAT. Internal right primer: GTTCCATGAGCAAATTGGGA. Internal WT amplicon: 3154 bp. Deletion size: 1369 bp. Deletion left flank: TATGTCTTTCAGTATATCAAAATTAAAAAT. Deletion right flank: ATGAACAACTCCTCTGACTTGATTTGAGAG. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1948 C. elegans R151.8(gk1047) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R151.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1047 homozygotes (sterile, does not lay eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCGTGGTCTTCTTCTTCTG. External right primer: AGTTCTTCTCGACGACGCAT. Internal left primer: GAGATGCATGTCGTGTCGAT. Internal right primer: ATTGTTTCAGCACGGGAAAG. Internal WT amplicon: 2188 bp. Deletion size: 1135 bp. Deletion left flank: GGTTCTTCTCGGAATTATTGTAGTTTTTGG. Deletion right flank: GTAGAATCTCCTGCCAATGACCATTTTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC195 C. elegans tag-18(gk109) X. Show Description
T14G12.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1950 C. elegans K02B7.3(ok2382) II. Show Description
K02B7.3. External left primer: GCTAATCAGCGGAAAAGCAC. External right primer: TTAATGCCAACAAACCGTGA. Internal left primer: GATTTTCTATCGCTCTGCCG. Internal right primer: GAAATTTCCAGAAATGCCCA. Internal WT amplicon: 2157 bp. Deletion size: 1347 bp. Deletion left flank: GCGACTGTTTTCCAAAGTGCTCCTCTGTCG. Deletion right flank: TTTTGTGGAGAGTCTGAAAATTTTAAAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1951 C. elegans gcy-29(ok2475)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
C04H5.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2475 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTGCCTACGTGGCAAGTACA. External right primer: AAAATGACTCACGAAACGGG. Internal left primer: TGCACGTGGCAAGGTATCTA. Internal right primer: TGCAAAAATGTTGGAGAGCA. Internal WT amplicon: 3309 bp. Deletion size: 1504 bp. Deletion left flank: TTGCAAATTCGGCAGAAGTTGCAGTGTATG. Deletion right flank: TTCAAAATGAACTTCCATACACTTACCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1952 C. elegans pmt-2(ok2419) V/nT1 [qIs51] (IV;V). Show Description
F54D11.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2419 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCCGAAATGAGACACCAC. External right primer: CCCACCCTCGATTTACAGTC. Internal left primer: GTTTTCGGTCGGTAGAGCAC. Internal right primer: TTTGAAATCGATCGAAAAATTG. Internal WT amplicon: 3161 bp. Deletion size: 2665 bp. Deletion left flank: TAGTTTTTCAATAAATAAATACACTTTTTT. Deletion right flank: GTTGGCAATCGCTTTGGAACGACTTCACGA. Insertion Sequence: AATCCTGAGCAAAAAAGTTAAGTAGTTGAAAAAAAGTTAAGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1953 C. elegans pms-2(ok2529) V. Show Description
H12C20.2. External left primer: ATTCGGCTCGATCAGGTAAA. External right primer: TGAAAGAAAACGTGTGCGAG. Internal left primer: GGTTGATCTAGCTTCGCCAG. Internal right primer: GAACATGTCGAATGAGGCAA. Internal WT amplicon: 2942 bp. Deletion size: 2158 bp. Deletion left flank: CATCTGATTAGGATATTGTGATACCACTGC. Deletion right flank: TAGCAGCAGATTGACGGCAAATGATATTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1954 C. elegans clec-68&clec-69(ok2549) IV. Show Description
F56D6.15, F56D6.1. External left primer: GTCTCGATTTGGTAGCAGGC. External right primer: AGACTGTGTGCCACCTGATG. Internal left primer: TGCACTCCAAGGATAGTCCC. Internal right primer: GGGCTGCTGTAGAAGGTCTG. Internal WT amplicon: 3106 bp. Deletion size: 2663 bp. Deletion left flank: TTTCAAACATCGTCTCAAAAGTCCGCAAGT. Deletion right flank: TTTTCTCAACTGATTTTGCATGGTTAAGTG. Insertion Sequence: TTCTCAACTGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1955 C. elegans lin-12(ok2215) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R107.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2215 homozygotes (sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCTTTTCTCGCAGCTCCA. External right primer: CATACATTTGCGTGTGTCCC. Internal left primer: GGGCTGTCATTCCGTTTCTA. Internal right primer: AAACCTGGGAACACATCGAC. Internal WT amplicon: 3327 bp. Deletion size: 1227 bp. Deletion left flank: ATTAATTCTGTTGGTGTGGTTTGGTTTTAT. Deletion right flank: GATTTCTAGAAAACAAACTGGTTGCTTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1956 C. elegans tam-1(ok2635) V. Show Description
F26G5.9. External left primer: TATCTCTTCCCAATCGGCAC. External right primer: CGAGTTCATGCTCAGCACAT. Internal left primer: TGTTTGCGAGAGAACCTTGA. Internal right primer: GTCTACTCGGAAGCTGGTGG. Internal WT amplicon: 1314 bp. Deletion size: 339 bp. Deletion left flank: GTTCATGTTCGGTTGCTGCATTCGTTGATG. Deletion right flank: ATGATTGAGCGCGCCTCGTAAATTTCTGGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1957 C. elegans sfxn-1.2(gk3039) II; flp-14(gk1055) III. Show Description
Y37D8A.15, F37H8.4. The allele gk1055 was identified by PCR screening, has been validated by CGH analysis, and can be detected with the following PCR primers. External left primer: CGGCAAGCCTAGTAGGTAGAC. External right primer: CGGAGAGCAATGTTGAGTCCTC. Internal left primer: CCTTTGCCAGTTTTTTCCCTTTGG. Internal right primer: TTCTTACAGGCAATGGCTGGAC. Internal WT amplicon: 2702 bp. Deletion size: 652 bp. Deletion left flank: GAAAAACGAAAATTGGCAGTAGGCAGGCAG. Deletion right flank: ACAGAGAGTAGGTAGACAATAAGCAGGCAA. The allele gk3039 was identified by CGH and not confirmed by PCR. Left flanking probe: TGTTAAATATTGGCCAGAGTTGACTCAATCTTTAGTTAATTTGGCGTAGT. Right flanking probe: CATCTGCCGAATTTTCCTTTATAACATTCCAGAACAAGAACAGTATTGCT. Left deleted probe: ACAGTTTCAGATGCCCGCCAACATGCTCATCAACGGAATGCTCTTGAGCC. Right deleted probe: GAGCTATGGCTGCTGCTCTGTCACTGAATGCGATGGTTAAGGTAAACAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1959 C. elegans B0285.6(ok2312) III. Show Description
B0285.6. External left primer: TGAGCTCCAGAATTCCAGGT. External right primer: CCTTATCCATTTTCGGCTCA. Internal left primer: TGAGCTCGCAGATGAGAGAA. Internal right primer: TCTTTGAGCCACGTCACAAC. Internal WT amplicon: 3197 bp. Deletion size: 1459 bp. Deletion left flank: GCTGTGCATTGATGGCTCCGATTGCCTATG. Deletion right flank: GACCATCATTCTCATTTATGCTTCCGATGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1961 C. elegans F26H9.8(ok2510) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F26H9.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2510 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAAACATCCCATCCCGAATA. External right primer: CCATTTCACGAATTTCGGTC. Internal left primer: GTGACCCTTCGAAAAGTGGA. Internal right primer: TTTCAGTTTTTGGCACGTTTT. Internal WT amplicon: 1143 bp. Deletion size: 783 bp. Deletion left flank: CAAGTGGAGGTCATCCTCGATTTTGGCCGA. Deletion right flank: CAAAATTCTAAAAAATCGGCACTTGGAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1962 C. elegans pbs-6&cids-1(ok2516) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C02F5.4, C02F5.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2516 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAGCGGTACTTGTGG. External right primer: CTTTCCTGCATCAAGCATCA. Internal left primer: TTTCTTCAATTGGAGGACATCT. Internal right primer: ATTCCAGGAAGATCGAGCAA. Internal WT amplicon: 2526 bp. Deletion size: 1268 bp. Deletion left flank: GTGGTGAGGATGATGTTATCATTCCTGAAT. Deletion right flank: CGTTGAAGAAGCGAAAAAGAATGCACAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1964 C. elegans F38B7.1(ok2506) V/nT1 [qIs51] (IV;V). Show Description
F38B7.1. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2506 homozygotes (Unc, mostly sterile with vulval blip, but some animals reproduce). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCATCTCACCGGAAGGAAC. External right primer: AACTTGGATGAAACGTTGGC. Internal left primer: AGCACCACCACCAAAGAATC. Internal right primer: AGCTATTGCGATTGCGGTAA. Internal WT amplicon: 2935 bp. Deletion size: 973 bp. Deletion left flank: GTCACAGTATCATAATGTCACAATGAAGCA. Deletion right flank: TTTCCCAATCAAATCTCTTCATTATTTTAT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807