| RB2398 |
C. elegans |
T01D3.2(ok3276) V. Show Description
T01D3.2 Homozygous. Outer Left Sequence: gcatcgagggaaaatgttgt. Outer Right Sequence: aaccgtcaaaatcacaagcc. Inner Left Sequence: tgaggaaacaaatgtgatcgag. Inner Right Sequence: ggcaagagcaatttctggac. Inner Primer PCR Length: 1199. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2399 |
C. elegans |
grl-25(ok3279) III. Show Description
ZK643.8 Homozygous. Outer Left Sequence: gaggatcgtcttattccggc. Outer Right Sequence: gagaccttgctctccacagg. Inner Left Sequence: gaggagaagcatcatcgtca. Inner Right Sequence: cgagatttgacacgttgagc. Inner Primer PCR Length: 1236. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2400 |
C. elegans |
cyn-2(ok3280) III. Show Description
ZK520.5 Homozygous. Outer Left Sequence: atggaaaatttgaacgtcgg. Outer Right Sequence: atggaaagttagttcggggg. Inner Left Sequence: tgcgaaaagaatcgatcagc. Inner Right Sequence: attccacaaacttgcatccc. Inner Primer PCR Length: 1235. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2401 |
C. elegans |
R02E4.1(ok3286) X. Show Description
R02E4.1 Homozygous. Outer Left Sequence: ttattcagatgggtttcggc. Outer Right Sequence: ttcgcaaagttcgactcctt. Inner Left Sequence: cgctgccaaataacaacctt. Inner Right Sequence: ttcttggttgatcaaatacctttt. Inner Primer PCR Length: 1103. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2402 |
C. elegans |
snt-5(ok3287) V. Show Description
R12A1.2 Homozygous. Outer Left Sequence: gcagtcggactatctttgcc. Outer Right Sequence: gatgcattatgagctggggt. Inner Left Sequence: gcacactaacctatcccagtcc. Inner Right Sequence: gtaattcgcgccaacaatct. Inner Primer PCR Length: 1139. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2403 |
C. elegans |
R03G8.4(ok3288) X. Show Description
R03G8.4. Homozygous. Outer Left Sequence: tgaggattttctggacctgg. Outer Right Sequence: cagagcggtaacgagctagg. Inner Left Sequence: gcattgaatcctcatttaggc. Inner Right Sequence: ctcacggtgcaattggaaat. Inner Primer PCR Length: 1169. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2404 |
C. elegans |
str-220(ok3289) IV. Show Description
C42D4.9 Homozygous. Outer Left Sequence: tgtaacacggcaggttcaaa. Outer Right Sequence: acattccgttttccatttgc. Inner Left Sequence: ttggcgccacttcttcttta. Inner Right Sequence: ccagactgtccaaaatccaga. Inner Primer PCR Length: 1146. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2405 |
C. elegans |
F42D1.3(ok3290) X. Show Description
F42D1.3 Homozygous. Outer Left Sequence: tgcctctgacacaattcgac. Outer Right Sequence: aattcagttgactgccgctt. Inner Left Sequence: agtttatgggcaggtttgtga. Inner Right Sequence: ttcaaagcccaatttcaagc. Inner Primer PCR Length: 1210. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2406 |
C. elegans |
R11E3.4(ok3291) IV. Show Description
R11E3.4 Homozygous. Outer Left Sequence: gatgtttgaaaggcttggga. Outer Right Sequence: cggtgaaactcacaggacaa. Inner Left Sequence: tcattaacatgagctactcgtcg. Inner Right Sequence: gctttccttgtgcctacacc. Inner Primer PCR Length: 1178. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2407 |
C. elegans |
cng-1(ok3292) V. Show Description
F14H8.6 Homozygous. Outer Left Sequence: caggagggtatccccaattt. Outer Right Sequence: gctcgtcgagaaacttttgg. Inner Left Sequence: ccagagtcagtgcagaccag. Inner Right Sequence: tgttcaggcacttcgaggat. Inner Primer PCR Length: 1263. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2408 |
C. elegans |
F18A12.6(ok3293) II. Show Description
F18A12.6 Homozygous. Outer Left Sequence: catccggcaacaaacctact. Outer Right Sequence: gttcaacttttccgtcgcat. Inner Left Sequence: gcgaagttctgggcaattta. Inner Right Sequence: tggtttccagtgcttttcag. Inner Primer PCR Length: 1237. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2409 |
C. elegans |
F54D5.14(ok3294) II. Show Description
F54D5.14 Homozygous. Outer Left Sequence: gctgcaatcaatttgggtct. Outer Right Sequence: tggatcgatcaacgtgatgt. Inner Left Sequence: atcgaggaaacacggtgaag. Inner Right Sequence: tgtgtgagccgaatctgaaa. Inner Primer PCR Length: 1283. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2410 |
C. elegans |
K09F5.1(ok3295) X. Show Description
K09F5.1 Homozygous. Outer Left Sequence: ctccgtcatgggaactgaat. Outer Right Sequence: catttcgccaaaagaggtgt. Inner Left Sequence: cttgacggcaggctataagg. Inner Right Sequence: agtgagccagtgtgctttga. Inner Primer PCR Length: 1324. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2412 |
C. elegans |
ins-35(ok3297) V. Show Description
K02E2.4 Homozygous. Outer Left Sequence: tgcctcctcgcaataatctt. Outer Right Sequence: ttgccgaaaattaccgattc. Inner Left Sequence: ccaactggaaaacaccacaa. Inner Right Sequence: caatttgtccatttgccgat. Inner Primer PCR Length: 1208. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2413 |
C. elegans |
F47G4.6(ok3298) I. Show Description
F47G4.6 Homozygous. Outer Left Sequence: ttttgcggaatcctcagttt. Outer Right Sequence: ggggtacttaccaggggtgt. Inner Left Sequence: aaacttgaaattttcggttcca. Inner Right Sequence: tcaatatttgccgagcacag. Inner Primer PCR Length: 1199. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2414 |
C. elegans |
C56E6.6(ok3309) II. Show Description
C56E6.6 Homozygous. Outer Left Sequence: tctaattgatttcccgccag. Outer Right Sequence: cgatgttctgcgttccaata. Inner Left Sequence: aggtgttgcaatttcggaag. Inner Right Sequence: tgtcgttctaatgctggcaa. Inner Primer PCR Length: 1117. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2415 |
C. elegans |
C44E4.6(ok3310) I. Show Description
C44E4.6 Homozygous. Outer Left Sequence: gccaaaggctaagcgtactg. Outer Right Sequence: gtttcagtcgcttcgagacc. Inner Left Sequence: ccgccgagtaatttcatctt. Inner Right Sequence: aacaattgctggcgattagg. Inner Primer PCR Length: 1354. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2416 |
C. elegans |
hda-10(ok3311) II. Show Description
Y51H1A.5 Homozygous. Outer Left Sequence: cgccgaaaatacggtatcac. Outer Right Sequence: tttcttctggaaaatgcgct. Inner Left Sequence: gggtctcgacacgaaaattg. Inner Right Sequence: gatcttgaatgcgtggtgtg. Inner Primer PCR Length: 1312. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2417 |
C. elegans |
F14H12.6(ok3312) X. Show Description
F14H12.6 Homozygous. Outer Left Sequence: ggaaatgccaaggcagatta. Outer Right Sequence: tccaacacgaaaatgtgagc. Inner Left Sequence: tttccgtgttttaagataagaacaaa. Inner Right Sequence: ctaaccttctgcatcctcgc. Inner Primer PCR Length: 1196. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2418 |
C. elegans |
mec-5(ok3313) X. Show Description
E03G2.3 Homozygous. Outer Left Sequence: tagttttcgagatacgggcg. Outer Right Sequence: aaataaaaacgtgcaagcgg. Inner Left Sequence: ttgtcaaaaacggactcacg. Inner Right Sequence: tgttcccaatctccatcaca. Inner Primer PCR Length: 1126. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2419 |
C. elegans |
Y44A6D.3(ok3314) V. Show Description
Y44A6D.3 Homozygous. Outer Left Sequence: tggacaacccgtagacacaa. Outer Right Sequence: gaaatgcatggttacggctc. Inner Left Sequence: aggtgttccaccagcacaat. Inner Right Sequence: gtcggttttcaaaatttccg. Inner Primer PCR Length: 1323. Deletion size: about 200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2420 |
C. elegans |
C06E7.3(ok3315) IV. Show Description
C06E7.3 Homozygous. Outer Left Sequence: gtgggggctactgattttga. Outer Right Sequence: gttctcgtccgaaacgtcat. Inner Left Sequence: agctggtccttgtgatttgg. Inner Right Sequence: acgatgattcctcgaaaggt. Inner Primer PCR Length: 1141. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2421 |
C. elegans |
R11A8.5(ok3316) IV. Show Description
R11A8.5 Homozygous. Outer Left Sequence: gccaccattcagcaattttt. Outer Right Sequence: accgatccgttgtgtttttc. Inner Left Sequence: tgaacgctgagcatccatag. Inner Right Sequence: cgcccgttttcttttaatg. Inner Primer PCR Length: 1218. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2422 |
C. elegans |
F53A3.2(ok3317) III. Show Description
F53A3.2 Homozygous. Outer Left Sequence: acatctccgattggcgtaag. Outer Right Sequence: gaatactcagccaagcagcc. Inner Left Sequence: atttttgggcgaatttttcc. Inner Right Sequence: cgattgcagtgcactttagg. Inner Primer PCR Length: 1237. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2423 |
C. elegans |
try-15(ok3329) I. Show Description
T21E12.3 Homozygous. Outer Left Sequence: ataccgtaatcgggtgttcg. Outer Right Sequence: catgcaacactggctcattt. Inner Left Sequence: gattcgtaacgctcgatgtg. Inner Right Sequence: tgatcagcaattgccctaga. Inner Primer PCR Length: 1340. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2424 |
C. elegans |
Y47D3A.1(ok3330) III. Show Description
Y47D3A.1 Homozygous. Outer Left Sequence: ccactttcctgattcccaga. Outer Right Sequence: agccaacgttcgaaacaaac. Inner Left Sequence: gacgttgatggctccatttt. Inner Right Sequence: cccactttacatggtttggg. Inner Primer PCR Length: 1248. Deletion size: about 250 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2425 |
C. elegans |
K08E4.2(ok3331) IV. Show Description
K08E4.2 Homozygous. Outer Left Sequence: aactccaatgaaaccgcaac. Outer Right Sequence: ttttctctgtgccctccagt. Inner Left Sequence: ctgcaaaatgcatagcgaaa. Inner Right Sequence: tgtttgttctgatacatggcaa. Inner Primer PCR Length: 1164. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2426 |
C. elegans |
K09C8.2(ok3332) X. Show Description
K09C8.2 Homozygous. Outer Left Sequence: acacgaggcccactgtaatc. Outer Right Sequence: cgttcaaacacaaccacctg. Inner Left Sequence: cgtaaggaacgagggatcaa. Inner Right Sequence: cggtctccctatcttcacca. Inner Primer PCR Length: 1171. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2427 |
C. elegans |
F13H8.11(ok3333) II. Show Description
F13H8.11 Homozygous. Outer Left Sequence: aaccaggagagcttgcaaaa. Outer Right Sequence: cttcttgaaaatggcacggt. Inner Left Sequence: ctgaaggaactcggagaaatc. Inner Right Sequence: gcgtttatggattcaatggg. Inner Primer PCR Length: 1272. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2428 |
C. elegans |
T02C1.1(ok3334) III. Show Description
T02C1.1 Homozygous. Outer Left Sequence: tgttcttctttccctcccct. Outer Right Sequence: tcgagaatcattcaacgcaa. Inner Left Sequence: cctttcgttcttaccttccg. Inner Right Sequence: ggtaaacaaaaagtggacaatgg. Inner Primer PCR Length: 1166. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2429 |
C. elegans |
sao-1(ok3335) V. Show Description
R10D12.14 Homozygous. Outer Left Sequence: aagagcgagatgacgaggaa. Outer Right Sequence: accatttgtccgagcaactc. Inner Left Sequence: gacatcaaaataccgacggc. Inner Right Sequence: gaacacgagaagcctgttcc. Inner Primer PCR Length: 1196. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2430 |
C. elegans |
tig-2(ok3336) V. Show Description
F39G3.8 Homozygous. Outer Left Sequence: gagttgtggaggcggatcta. Outer Right Sequence: agtgtttccagacaggccac. Inner Left Sequence: tcagagctttagcggcaaat. Inner Right Sequence: aacaaatccgcgagctctt. Inner Primer PCR Length: 1207. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2431 |
C. elegans |
T23G11.7(ok3337) I. Show Description
T23G11.7 Homozygous. Outer Left Sequence: aatgtctgcgaatctcccac. Outer Right Sequence: aaaagcatacggacactggg. Inner Left Sequence: atctcattttccccgctttt. Inner Right Sequence: aaaaggattgatggaataaatcaga. Inner Primer PCR Length: 1184. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2432 |
C. elegans |
nas-21(ok3342) V. Show Description
T11F9.5 Homozygous. Outer Left Sequence: ccactttgcataatctcgca. Outer Right Sequence: catatagcccgcatccaaat. Inner Left Sequence: tccaatcagagctacgagca. Inner Right Sequence: tgattctacaatgacagctggttt. Inner Primer PCR Length: 1244. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2433 |
C. elegans |
ZK353.8(ok3343) III. Show Description
ZK353.8 Homozygous. Outer Left Sequence: tggcccatcgtttttcttag. Outer Right Sequence: agatggccagattttcgatg. Inner Left Sequence: tcgagtcttgttgttttccg. Inner Right Sequence: ggcaacatatcgattcgtca. Inner Primer PCR Length: 1251. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2434 |
C. elegans |
asg-2(ok3344) X. Show Description
C53B7.4 Homozygous. Outer Left Sequence: tccagaccggaggatacaag. Outer Right Sequence: atggcaaacttttgggtgac. Inner Left Sequence: tttgagcattagagtgagtttttg. Inner Right Sequence: ccagtaggcatagtggggtg. Inner Primer PCR Length: 1276. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2435 |
C. elegans |
C24G6.3(ok3345) V. Show Description
C24G6.3 Homozygous. Outer Left Sequence: aaaattggattttggagggg. Outer Right Sequence: gccattattgccgattttct. Inner Left Sequence: tctttgacggtttttctgaatg. Inner Right Sequence: tttgaaaagttaaaaacatacagatgc. Inner Primer PCR Length: 1193. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2436 |
C. elegans |
F59A7.9(ok3359) V. Show Description
F59A7.9 Homozygous. Outer Left Sequence: cctacacctgcctacttgcc. Outer Right Sequence: ccctacagtactccggcaga. Inner Left Sequence: ctaccaaagacgccttaccg. Inner Right Sequence: ttctccaatcaactacctccaa. Inner Primer PCR Length: 1194. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2437 |
C. elegans |
T13B5.8(ok3360) II. Show Description
T13B5.8 Homozygous. Outer Left Sequence: tgcaaatcagctctaatgcg. Outer Right Sequence: ggtggccgagtctaaagtca. Inner Left Sequence: aagtgtttcaagtgcgctcc. Inner Right Sequence: ccagttttccgtcgattttc. Inner Primer PCR Length: 1164. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2438 |
C. elegans |
ZK270.2(ok3361) I. Show Description
ZK270.2 Homozygous. Outer Left Sequence: catatgcaaaggtgtccacg. Outer Right Sequence: tcttcagcaaggcatctcct. Inner Left Sequence: gaagtgatgtattcctgtttcgt. Inner Right Sequence: agccttcagagaaatcgtcg. Inner Primer PCR Length: 1225. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2439 |
C. elegans |
F13D2.2(ok3362) X. Show Description
F13D2.2 Homozygous. Outer Left Sequence: aagcgggattcgaaggtatt. Outer Right Sequence: tcaaaacgttgcttgcattc. Inner Left Sequence: tgtcacagatagggaccgaa. Inner Right Sequence: ctagttgacggtagcaacgc. Inner Primer PCR Length: 1136. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2440 |
C. elegans |
C01B12.3(ok3363) II. Show Description
C01B12.3 Homozygous. Outer Left Sequence: aaccatttccctcatttcca. Outer Right Sequence: tcatcatcctctcccaaagg. Inner Left Sequence: tcactcgatgttgcttcttctt. Inner Right Sequence: gagaagcacttcggcaactt. Inner Primer PCR Length: 1105. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2441 |
C. elegans |
uba-5(ok3364) I. Show Description
T03F1.1 Homozygous. Outer Left Sequence: tttaaaccgccttggaaatg. Outer Right Sequence: agtgtgatggaaggcgagag. Inner Left Sequence: gaaagaccaccctctggagtc. Inner Right Sequence: gctccgactcatttaccagc. Inner Primer PCR Length: 1112. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2442 |
C. elegans |
C08E3.13(ok3365) II. Show Description
C08E3.13 Homozygous. Outer Left Sequence: gtcgaaaagttgccgaagtt. Outer Right Sequence: tcttcaaattaccaaggccg. Inner Left Sequence: acagccctggtgcagaacta. Inner Right Sequence: ggaaatgcgaatcccaacta. Inner Primer PCR Length: 1267. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2443 |
C. elegans |
abf-3(ok3366) V. Show Description
F54B8.5 Homozygous. Outer Left Sequence: tgcgaaacattccacagaaa. Outer Right Sequence: agatggcagacacgaagaca. Inner Left Sequence: agtttccagaagtcatgccc. Inner Right Sequence: cacagagtacgcttgcaaaa. Inner Primer PCR Length: 1126. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2444 |
C. elegans |
Y47G6A.3(ok3367) I. Show Description
Y47G6A.3 Homozygous. Outer Left Sequence: tggtcaagaacgtgctgaag. Outer Right Sequence: cagatcggcaattcggtaat. Inner Left Sequence: atcaaaccgtaacgggacag. Inner Right Sequence: tcagcagttatccaactccaaa. Inner Primer PCR Length: 1196. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2445 |
C. elegans |
tmd-2(ok3368) V. Show Description
C08D8.2Homozygous. Outer Left Sequence: ttacagaggcaatgcacgag. Outer Right Sequence: aaccggggatatcatcacaa. Inner Left Sequence: ccgaattgtttcttgggatg. Inner Right Sequence: tacaatccgttgcgtcaaaa. Inner Primer PCR Length: 1182. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2446 |
C. elegans |
C49C8.5(ok3369) IV. Show Description
C49C8.5 Homozygous. Outer Left Sequence: ttttgtgcctacccgtatcc. Outer Right Sequence: tatggccaattttcagaccc. Inner Left Sequence: gccgttgtcatcatcgtaaa. Inner Right Sequence: ttttgttactgttccagggctt. Inner Primer PCR Length: 1200. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2447 |
C. elegans |
str-220(ok3374) IV. Show Description
C42D4.9 Homozygous. Outer Left Sequence: tgtaacacggcaggttcaaa. Outer Right Sequence: acattccgttttccatttgc. Inner Left Sequence: ttggcgccacttcttcttta. Inner Right Sequence:ccagactgtccaaaatccaga . Inner Primer PCR Length: 1146. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2448 |
C. elegans |
ZC84.3(ok3375) III. Show Description
ZC84.3 Homozygous. Outer Left Sequence: cttgggaaaccttgtcgtgt. Outer Right Sequence: caaacatttccctttttggc. Inner Left Sequence: caaagaaagacccgtttcca. Inner Right Sequence: tgcaaatatgttccaatcaataca. Inner Primer PCR Length: 1312. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|