Search Strains

oxTi983 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-14.58). Insertion into src-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.

oxTi984 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-15.12). Insertion into srh-72. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.

oxTi986 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:-20.67). Insertion into T08D2.2. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.

oxTi987 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:20.20). Insertion into dyf-17. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.

oxTi988 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:3.23). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.

oxTi989 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:19.10). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.

oxTi991 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:5.59). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.

oxTi992 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-15.96). Insertion into K10B4.1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.

oxTi993 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:25.92). Insertion into Y105E8B.7. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.

oxTi994 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:2.45). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.

oxTi995 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-0.03). Insertion into pqn-44. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.

oxTi996 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:6.87). Insertion into mbk-2. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.

oxTi997 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:2.06). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.

oxTi998 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:6.23). Insertion into F14D7.14. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.

oxTi999 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:6.72). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.

oxTi1000 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:15.17). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.

oxTi1001 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-0.45). Insertion into C06G4.6. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.

oxTi1002 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:19.25). Insertion into Y40B1A.3. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.

oxTi1003 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:24.09). Insertion into dhs-30 and T24G12.3. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.

oxTi1005 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-14.69). Insertion into srd-69. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.

oxTi1006 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:-19.95). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.

oxTi1007 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:5.53). Insertion into srd-11. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1008 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:3.75). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1009 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-18.96). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1010 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:10.79). Insertion into tbc-17. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1011 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-1.99). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1014 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:4.62). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1015 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:12.63). Insertion into srd-50. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1016 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-18.09). Insertion into Y95B8A.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1017 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:3.20). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1018 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:21.64). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1019 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:-7.36). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1020 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:-2.60). Insertion into C04F5.2. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1021 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:6.85). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1022 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:22.34). Insertion into Y71A12B.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1023 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:4.05). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1024 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-3.80). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxSi255 [snt-1p::GFP + Cbr-unc-119(+)] I. Integration into ttTi4348 mosSCI site (I:-5.32). Pan-neuronal GFP expression visible under dissection microscope. oxTi81 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] V. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr.V: 1.21. Him. Combined fluorescent balancer strain for LG I and LG IV. Strain contains him-5(e1490) to generate males for crosses.

oxSi1106 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + lox2272] II. Unc. Integrated Cas9 transgene inserted into ttTi5605 MosSci site. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883

Superficially wild-type. Deletion of his-69 and his-70; complex substitution with an insertion at break site: aacaaatcagttctcacttttagcc-TCTTGGATTTAATAAATAAATTA-agtttaagtttccgccaatgaaaaa. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

zzIs16 [(pJE3) eff-1p::GFP + rol-6(su1006)]. GFP+ Rollers. Chromosomal insertion of zzEx10. Integration site of zzIs16 not yet mapped, but it is not tightly linked to eff-1 II, unc-119 III, or jcIs1 IV. pJE3 has 7.5 kb of eff-1 upstream sequence inserted into pPD95.75, driving cytoplasmic GFP expression.

Extreme coiler from L1 to adult. Hypomorph. f131/nDf17 is L1 lethal. Molecular lesion: g to a transition in splice donor site of exon 6 (g3485a) in ZK637.8 gene encoding a V-ATPase alpha subunit.

xnSi31 [sec-8::mCherry + unc-119(+)] II. Expresses sec-8::mCherry maternally and zygotically. Expression is present in many cells, including early embryos, epithelial cells, the excretory cell, and the germ line. Transgene was inserted by MosSCI into ttTi5605 excision site. Derived from WM186. Reference: Armenti ST, Chan E, Nance J. Dev Biol. 2014 Aug 4. pii: S0012-1606(14)00355-8.

xnSi34 [sec-15::YFP + unc-119(+)] II. Expresses sec-15::YFP maternally and zygotically. Expression is present in many cells, including early embryos, epithelial cells, the excretory cell, and the germ line. Transgene was inserted by MosSCI into ttTi5605 excision site. Derived from WM186. Reference: Armenti ST, Chan E, Nance J. Dev Biol. 2014 Aug 4. pii: S0012-1606(14)00355-8.

Break points: lin-42 II. Covered region (Mb) (1.2) Balancer marked with myo-2p::mCherry. tmIs1226 is integrated in the same site as tmIs1246, but Egl phenotype is not detectable. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Temperature sensitive: sterile at 25C. Maintain at 15C. Him. Eri. Due to a direct repeat the exact site and sequence of the 23 bp eri-1(mg366) insertion is unclear, however, the insertion lies in exon 6 of T07A9 between nucleotide positions 35215 and 35204 of cosmid T07A9 and includes 23 or these 32 nucleotides tttatcgaaaaaaaaacaggcactttatcgaa. Primers to follow eri-1mg366: GATAAAACTTCGGAACATATGGGGC and ACTGATGGGTAAGGAATCGAAGACG. These primers will give a 170 bp product in N2 and a 193 bp product in eri-1(mg366).

Superficially wild-type.  Mutation in active site of ddi-1 protease.

rde-1(ar660)[rde-1(lox2272-flexon-lox2272)]. 9th intron of rde-1 replaced with a flexon - an artificial exon flanked by artificial introns that each contain a lox2272 site (a flexon). Severely reduces rde-1 function, function can be restored upon excision of the flexon by Cre recombinase. Reference: Shaffer JM & Greenwald I. Proc Natl Acad Sci U S A. 2022 Jan 18;119(3):e2117451119. doi: 10.1073/pnas.2117451119. PMID: 35027456.

nuIs11 [osm-10::GFP + lin-15(+)]. Array contains pool28; KP#57-59 (osm-10::GFP insert at Nrul site) and pJM24 [lin-15(+) rescues n765 at 20C]. GFP expressed in ASH, ASI, PHA and PHB after 3-fold. nuIs11 may be inserted on LG I.

goeIs288 [flp-11p::mKate2::unc-54 3'UTR + unc-119(+)]. Low copy number insertion. Integration site unknown, but likely not in LG II. Reference: Turek et al. eLife 2016;5:e12499.