More Fields
Strain Species Genotype
RB1653 C. elegans ctl-3(ok2042) II. Show Description
Y54G11A.13. Homozygous. Outer Left Sequence: CGGCGATTCTTATACTCCCA. Outer Right Sequence: CTTCCCCACATGGTCAATCT. Inner Left Sequence: GGCCAATTTTCTGCCTGATA. Inner Right Sequence: CAACTGCTTTCGCATGGTTA. Inner Primer PCR Length: 2912 bp. Deletion Size: 1420 bp. Deletion left flank: CATTTCCGAAATCCGGATGAACTTTCGTGAACTCTTTGACCATTCCATTTTGAATTTCC TCCAAACAGCCACCCAAATCACTAGCCAAATTCCCAACGAGCCGATCTCTCTCCTCCTC CTTGAGCACTTTCTCCCAGAACTGACGTGGCTGCTCGTAGTTGTGATCGTCTCCAGT. Deletion right flank:  ATGGATTGAACTCCCATTTCTCAGCTTGTTCGAATGTCATCACTTGAATGAACATCTTC CATTCCGGGAAATTTCTTGACTCAATGGCATTGAACAGGTCGCGGATCGCATAGTCTGG ATCCGAAGAGGCGAGCTTTCCAGCGTCAGTTGGATCGAGATTCTTGGAACCTTGAGCAG GCTGAAAAATAGAAAATGAAAATTTAATTCTAGTCCCCGTCTCTCTTAGGCTTACCTTG . Insertion Sequence: GGATTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
GA800 C. elegans wuIs151. Show Description
wuIs151 [ctl-1(+) + ctl-2(+) + ctl-3(+) + myo-2p::GFP].  wuIs151 contains multiple copies of a PCR fragment containing the entire ctl-1 ctl-2 ctl-3 gene cluster.  Slow growing, especially at 25 degrees.  Raise at 20 degress or cooler.