| RB2627 |
C. elegans |
srg-69(ok3686) II. Show Description
F09E5.4 Homozygous. Outer Left Sequence: acatgttgtgcagcattggt. Outer Right Sequence: gcaaagatatcgtggctggt. Inner Left Sequence: gcgacctacggcaaaattag. Inner Right Sequence: gcaacagaaaccattctagcac. Inner Primer PCR Length: 1264. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2628 |
C. elegans |
Y73B3B.2(ok3687) X. Show Description
Y73B3B.2 Homozygous. Outer Left Sequence: tgaaaacgtgctcgtacacc. Outer Right Sequence: atgactacggtagatggcgg. Inner Left Sequence: tcgtgcaaagtttgagcatt. Inner Right Sequence: ggaccgaaacatttttgcat. Inner Primer PCR Length: 1130. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB2629 |
C. elegans |
Y46G5A.35(ok3697) II. Show Description
Y46G5A.35 Homozygous. Outer Left Sequence: cttcaggaatcggtttcagc. Outer Right Sequence: agaagccgaagagaaaagcc. Inner Left Sequence: taatctcctcctcagccgtc. Inner Right Sequence: cacatgaagcgtcttcggta. Inner Primer PCR Length: 1314. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB50 |
C. elegans |
okIs46 I. Show Description
okIs46 I. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.
|
|
| RB5000 |
C. elegans |
dpy-1(ok5083) III. Show Description
Whole-genome sequenced strain. Dpy. It has not been confirmed that this phenotype is the result of ok5083. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to ok5083, it is homozygous for 196 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
|
|
| RB5001 |
C. elegans |
Show Description
Whole-genome sequenced strain. Dpy. The mutation responsible for this phenotype has not been identified. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). It is homozygous for 289 mutations determined from sequence data, all of which are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
|
|
| RB5002 |
C. elegans |
Show Description
Whole-genome sequenced strain. Unc. The mutation responsible for this phenotype has not been identified. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). It is homozygous for 477 mutations determined from sequence data, all of which are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
|
|
| RB503 |
C. elegans |
sng-1(ok234) X. Show Description
T08A9.3. Homozygous. Outer Left Sequence: AATTTCCAACGACGTTTTCG. Outer Right Sequence: ATGGGTTTGATGGTGGTTGT. Inner Left Sequence: AATGCATGCCCTGTACATCA. Inner Right Sequence: GCAGCACCAGATTGGTATGA. Inner primer WT PCR product: 3359. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB509 |
C. elegans |
F54D7.3(ok238) I. Show Description
F54D7.3 Homozygous. Outer Left Sequence: CATAATCCCCTGAACCCCTT. Outer Right Sequence: CACCTGCTAACATTCGCTGA. Inner Left Sequence: TCAATCAGTGCACCTTTTCG. Inner Right Sequence: CGAATATCCTTCGGAATCCA. Inner Primer PCR Length: 3269. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB51 |
C. elegans |
okIs47 X. Show Description
okIs47 X. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.
|
|
| RB511 |
C. elegans |
T05A7.11&fut-5(ok242) II. Show Description
T05A7.11, T05A7.10. Homozygous. Outer Left Sequence: CAACATGTTCGGGAGTGATG. Outer Right Sequence: GCCACTCCATTTTTCGATGT. Inner Left Sequence: ACAGCAATGTCAAGCATTCG. Inner Right Sequence: ACGGGATATCAATGAGACGG. Inner Primer PCR Length: 3185 bp. Deletion Size: 1882 bp. Deletion left flank: TCGTAACTCCTTCATCATCTGGTTTCAAAT. Deletion right flank: ATGGAATATCATATCGTCGATTTTTATTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB512 |
C. elegans |
D2030.5(ok243) I. Show Description
D2030.5 Homozygous. Outer Left Sequence: gcttcaacttccactgctcc. Outer Right Sequence: tctcaagcacattggtctcg. Inner Left Sequence: ccaagtagccttcatctcgc. Inner Right Sequence: cccatgtgcgtaaggaattt. Inner Length: 3121. Estimated Deletion Size: 1621. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB515 |
C. elegans |
tag-10(ok246) II. Show Description
C31C9.1. Homozygous. Outer Left Sequence: AATGTGCTAATCCGCAAACC. Outer Right Sequence: TAATCATTTTCCAGCCCTCG. Inner Left Sequence: CCTGGGATATTTTCGCAGAC. Inner Right Sequence: CGATCATCCACTCGTCATTG. Inner primer WT PCR product: 2333. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB518 |
C. elegans |
nos-1(ok250) II. Show Description
R03D7.7. Homozygous. Outer Left Sequence: CAACTTCTTGAAGGCTTCGG. Outer Right Sequence: TGTCTTGCGTTGATTTGCTC. Inner Left Sequence: CTTGGCTATTGCCCAACATT. Inner Right Sequence: TTGAGGGAATTCAAACAGGG. Inner primer WT PCR product: 3076. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB525 |
C. elegans |
pgl-3(ok257) V. Show Description
C18G1.4a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB526 |
C. elegans |
C55C3.3(ok258) IV. Show Description
C55C3.3. Homozygous. Outer Left Sequence: tgaatcggaaaaatcgaagg. Outer Right Sequence: gatctaccaagaatgcggga. Inner Left Sequence: caggtctcgccacgatttat. Inner Right Sequence: tttgtctgggcgaaaaattc. Inner primer WT PCR product: 3283. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB541 |
C. elegans |
exc-5(ok271) IV. Show Description
C33D9.1a. Homozygous. Outer Left Sequence: taccttttggttgtgtgcca. Outer Right Sequence: caattaccgtcccaaccatc. Inner Left Sequence: ccaatagttgcggaaggaaa. Inner Right Sequence: attggactttgatgcggttc. Inner primer WT PCR product: 3388. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB545 |
C. elegans |
pek-1(ok275) X. Show Description
F46C3.1. Homozygous. eukaryotic initiation factor 2 alpha kinase PEK. Outer Left Sequence: ctgagccatcgacaaactca. Outer Right Sequence: ccttggtaccattcaacgct. Inner Left Sequence: ctgagaaggcaacgctctct. Inner Right Sequence: atcaccgctactctggatgg. Inner primer WT PCR product: 2967. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB552 |
C. elegans |
aap-1(ok282) I. Show Description
Y110A7A.10. Homozygous. Outer Left Sequence: GGACTCCGAGCTACTCAACG. Outer Right Sequence: ATGGGGGACAAGTGGATGTA. Inner Left Sequence: AATGAGCTTGTCGAGGAGGA. Inner Right Sequence: GGAGATGGAGAATCCCATGA. Inner primer WT PCR product: 2661. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB557 |
C. elegans |
T28F4.2(ok289) I. Show Description
T28F4.2. Homozygous. Outer Left Sequence: GTGTGTGTGCAAAATGGAGG. Outer Right Sequence: ATAGTCCAAGCCACAAACCG. Inner Left Sequence: ATTGAAGGTTCGCTTGTTGG. Inner Right Sequence: AGCTCGTAGCTGAGCGTTTC. Inner primer WT PCR product: 3219. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB559 |
C. elegans |
srp-8(ok291) V. Show Description
F20D6.3. Homozygous. Outer Left Sequence: GATGCCGGAAAAAGATGAAA. Outer Right Sequence: GTTATCATCCAGCAAATACACC. Inner Left Sequence: GTTGCACAATACGTATGTATTCTC. Inner Right Sequence: CTTTGGTGTTAGTTGCAGGAG. Inner primer WT PCR product: 1526. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB56 |
C. elegans |
okIs52 II. Show Description
okIs52 II. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.
|
|
| RB562 |
C. elegans |
fmo-4(ok294) V. Show Description
F53F4.5. Homozygous. Outer Left Sequence: GCATATGGTACATTTGCCCC. Outer Right Sequence: AAATCAACTCAAACCGCACC. Inner Left Sequence: GCTTCATTGGCGGTAAACAT. Inner Right Sequence: CTCCTCCTCCTCCTTCTCGT. Inner primer WT PCR product: 2475. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB563 |
C. elegans |
aaim-1(ok295) X. Show Description
Dopamine receptor knockout. [NOTE: (3/3/2025) ok295 was previously described as an allele of dop-3/T14E8.4, but is actually an allele of aaim-1/T14E8.4.1 according to current gene models.] Outer Left Sequence: ttgctccagcggttctagtt. Outer Right Sequence: gactgtctaagcgaccagcc. Inner Left Sequence: ttgtttgcgggtttgataca. Inner Right Sequence: agaagcacgcggtagttgat. Inner Primer PCR Length: 3254. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB564 |
C. elegans |
gcy-31(ok296) X. Show Description
T07D1.1. Homozygous. Outer Left Sequence: ctacgacaattgcgggagat. Outer Right Sequence: aggcttaggcaaggcttagg. Inner Left Sequence: aaaatttccgcattttgtgg. Inner Right Sequence: ggcctaaaacattggcttga. Inner primer WT PCR product: 3072. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB567 |
C. elegans |
svh-5(ok284) X. Show Description
C33A11.4/tag-97. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB568 |
C. elegans |
svh-5(ok286) X. Show Description
C33A11.4/tag-97. Homozygous. Outer Left Sequence: GTTTATAGTCTGGTCTCACACAAGG. Outer Right Sequence: AATCGTCTGGTGTCTGTTTGACC. Inner Left Sequence: TACGAGCTGCACCAGATCTCG. Inner Right Sequence: TTACAGATTCTTCGTGAGACC. Inner primer WT PCR product: 3537. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB569 |
C. elegans |
K08C7.6(ok299) IV. Show Description
K08C7.6. Homozygous. Outer Left Sequence: CTTATGCAGAGCATCACGGA. Outer Right Sequence: GCATATTTTAGCCATGCCGT. Inner Left Sequence: ATGGCGTTCTTGTCTGCTCT. Inner Right Sequence: AATTTTCCAATTTTTCGGGC. Inner primer WT PCR product: 2965. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB570 |
C. elegans |
srgp-1(ok300) IV. Show Description
F12F6.5. Homozygous. Outer Left Sequence: GATGTGAAGGCTGACAAGCA. Outer Right Sequence: TAACCCGTGCATTTGTTGAA. Inner Left Sequence: CTTCGAGGCCAATCATCAAT. Inner Right Sequence: GCCAAAACTATCATGGGCTG. Inner Primer PCR Length: 2904 bp. Deletion Size: 1406 bp. Deletion left flank: ttttattactttgttttatatttcaaaaac. Deletion right flank: atcaagtcgatcttcaaatcgatcaaaagc. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB574 |
C. elegans |
alg-2(ok304) II. Show Description
T07D3.7. Homozygous. Outer Left Sequence: tctgagtttggctcgatgtg. Outer Right Sequence: atgttccttggataccagcg. Inner Left Sequence: agcccagaactgggaaactt. Inner Right Sequence: aagtcgaattccgttggatg. Inner primer WT PCR product: 3297. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB575 |
C. elegans |
F16H11.3(ok305) X. Show Description
F16H11.3. Homozygous. Outer Left Sequence: atcggcaaaggattcatcag. Outer Right Sequence: ttcttgtctggctgcctttt. Inner Left Sequence: tccattgtggctatgagctg. Inner Right Sequence: gatcgaacacctatgccgtt. Inner primer WT PCR product: 3216. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB578 |
C. elegans |
C53D5.5(ok311) I. Show Description
C53D5.5. Homozygous. Outer Left Sequence: ccagcttctagccgcataac. Outer Right Sequence: caggtctcgaaacgaccaat. Inner Left Sequence: cccgtttttcagctttgtgt. Inner Right Sequence: acgggcaatattttcggaat. Inner primer WT PCR product: 2904. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB579 |
C. elegans |
ife-2(ok306) X. Show Description
R04A9.4. Homozygous. Outer Left Sequence: AAACATTCGTTCATTTCCGC. Outer Right Sequence: GCACAGCAGCGATGTAAAAA. Inner Left Sequence: ATTTAAGTGGCTGGTGTGGC. Inner Right Sequence: CGTTTTGCCAATCGAATTTT. Inner primer WT PCR product: 2315. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB58 |
C. elegans |
okIs54 V. Show Description
okIs54 V. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.
|
|
| RB582 |
C. elegans |
C04G6.1(ok219) II. Show Description
C04G6.1 Homozygous. Outer Left Sequence: ACCCGTCATTTCTGAAAACG. Outer Right Sequence: GCCAACCTGGTGTCGTAGTT. Inner Left Sequence: GACGTGCTTTGTGCGAATTA. Inner Right Sequence: CACTTGAGCTCCCTCGAATC. Inner Primer PCR Length: 2564. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB584 |
C. elegans |
zag-1(ok214) IV. Show Description
F28F9.1. 7/03: Not homozygous (Mark Edgley). Outer Left Sequence: CTCCTCCCTGTCTCTCGTTG. Outer Right Sequence: TGAAGGAAAAAGCGAAGCAT. Inner Left Sequence: TGGCGAGGAAATTAAGTTGG. Inner Right Sequence: AGACGTTTATTGGCACAGCC. Inner primer WT PCR product: 2791. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB592 |
C. elegans |
srp-6(ok319) V. Show Description
C03G6.19. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB594 |
C. elegans |
glc-3(ok321) V. Show Description
ZC317.3. Homozygous. Outer Left Sequence: TCAAAATACAGGGGTAGGCG. Outer Right Sequence: ACAATTCCTGGAACTCACGG. Inner Left Sequence: TGAAGAGGTTTTGAAACGCA. Inner Right Sequence: ACTTTCCGAGAGGAATGGGT. Inner Primer PCR Length: 2747 bp. Deletion Size: 1258 bp. Deletion left flank: GCGATTTTTGTGCTTGGCGTCAAAAATGAT. Deletion right flank: AAATGCATCGGACATGACAAAACCATCGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB595 |
C. elegans |
unc-73(ok322) I. Show Description
F55C7.7d. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB60 |
C. elegans |
okIs56 II. Show Description
okIs56 II. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.
|
|
| RB607 |
C. elegans |
nlp-12(ok335) I. Show Description
M01D7.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB608 |
C. elegans |
tag-96(ok336) IV. Show Description
M01D7.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB61 |
C. elegans |
okIs57 X. Show Description
okIs57 X. Pharyngeal GFP element integrated near unc-3 Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.
|
|
| RB62 |
C. elegans |
okIs58 III. Show Description
okIs58 III. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.
|
|
| RB622 |
C. elegans |
fzr-1(ok380) II. Show Description
ZK1307.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB625 |
C. elegans |
EEED8.6(ok382) II. Show Description
EEED8.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB626 |
C. elegans |
gcy-37(ok384) IV. Show Description
C54E4.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB630 |
C. elegans |
rpm-1(ok364) V. Show Description
C01B7.6 Homozygous. Outer Left Sequence: cgaatctcctccacggaata. Outer Right Sequence: atcgatttgatggtacggga. Inner Left Sequence: tggaatggattctggtggat. Inner Right Sequence: gagttgggctgtatggagga. Inner Length: 2972. Estimated Deletion Size: 2272. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB631 |
C. elegans |
srp-2(ok350) V. Show Description
C05E4.1. Homozygous. Outer Left Sequence: CTTACTGCCGCAAATCTTCGCGA . Outer Right Sequence: GTTGCGTAGAACTTTCGAGCCTA. Inner Left Sequence: CACTTTATGACGGCACAAAAAAG. Inner Right Sequence: GTGTTATTCTAATTGTCTCGGAAC. Inner primer WT PCR product: 2719. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB633 |
C. elegans |
ptp-3(ok244) II. Show Description
C09D8.1a. Homozygous. Outer Left Sequence: gcattttgtttgccctgttt. Outer Right Sequence: tgcaatcgttttggaaatca. Inner Left Sequence: cctcctcgtatcctcgttca. Inner Right Sequence: tctccctgtcctctatccga. Inner primer WT PCR product: 2578. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|