Search Strains

F45E4.8 Homozygous. Outer Left Sequence: caacggggaggaagactgta. Outer Right Sequence: atgtcgtcctccagaaatgg. Inner Left Sequence: tgttgatttacgcgaagctg. Inner Right Sequence: tgtacaattggcagacccaa. Inner Primer PCR Length: 2482. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23B2.7 Homozygous. Outer Left Sequence: atcggaagctgcaaactgat. Outer Right Sequence: ccttcgatttttccgattca. Inner Left Sequence: tacatgtcgtgcatggttcc. Inner Right Sequence: cgccagaatatccttttcca. Inner Primer PCR Length: 1915. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y59H11AL.1 Homozygous. Outer Left Sequence: tggaacacttccccaaactc. Outer Right Sequence: tgatacgggaaaagctacgc. Inner Left Sequence: ggaagcagtttgctctccag. Inner Right Sequence: aattggcagagttgtttcgg. Inner Primer PCR Length: 3299. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y45F10B.8 Homozygous. Outer Left Sequence: cgaaaagcttgcattcacaa. Outer Right Sequence: aggagacccaggaaaccact. Inner Left Sequence: aatcacacctggtctggagg. Inner Right Sequence: gtctcgatgcgtcttgatga. Inner Primer PCR Length: 2233. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1251.8 Homozygous. Outer Left Sequence: aagtgcagcttccacattcc. Outer Right Sequence: atacaacaggcggtgtaggc. Inner Left Sequence: ctgacggctttgctcttttc. Inner Right Sequence: attgttgagccgattggaac. Inner Primer PCR Length: 3116. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08E7.7. Homozygous. Outer Left Sequence: TGTTCGTTTTCTGATCGACG. Outer Right Sequence: TGGAAATCAGGCCTTTCAAC. Inner Left Sequence: AATGAGCAATGTGTGGGTGA. Inner Right Sequence: AAAAACCTTCAACCAGGGGT. Inner Primer PCR Length: 3040 bp. Deletion Size: 1059 bp. Deletion left flank: TGGCCATGCACCAGTTGTTTGAAGAATAAC. Deletion right flank: TCCAAAAGACGTTCAAACTCGCTATGCAAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C49A9.7. Homozygous. Outer Left Sequence: GACAACGTGTCCCCTACCAC. Outer Right Sequence: CCCCCATGCTTAGAAAGTCA. Inner Left Sequence: GACGAAATGGATCTGCGATT. Inner Right Sequence: AGGTACCGTATTTTTGGGGC. Inner Primer PCR Length: 2963 bp. Deletion Size: 737 bp. Deletion left flank: ACACGGGATTCTCATGGTCTTATAATTATT. Deletion right flank: TTCCAGCATTTCTTGCGTCAAAGGTATGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y37A1C.1a Homozygous. Outer Left Sequence: cgccggatttccactaagta. Outer Right Sequence: gtgacgcttgtgacgagaaa. Inner Left Sequence: aaagtgacgagagccgagaa. Inner Right Sequence: ggcttcacgtgctaaaggag. Inner Primer PCR Length: 3196. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y73F8A.34. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F37C4.6 Homozygous. Outer Left Sequence: ttcgtacttgctgtgttggc. Outer Right Sequence: tttgctcttgccgacttttt. Inner Left Sequence: ggtcaccgcaactaaatcgt. Inner Right Sequence: ggcggacacaatggtcttac. Inner Primer PCR Length: 2946. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C07G1.3 Homozygous. Outer Left Sequence: tgcttgcttccaatgacttg. Outer Right Sequence: ggccattgtcagtacgtgtg. Inner Left Sequence: gaaagtcggaaccattgtgg. Inner Right Sequence: gtagtcggtgggcagaaatg. Inner Primer PCR Length: 3332. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13B12.3 Homozygous. Outer Left Sequence: tgggctaaatgcgagtatcc. Outer Right Sequence: tcccacgagttagatgctca. Inner Left Sequence: tgaggaaattgttttcggga. Inner Right Sequence: ctcggtgaattggctcctac. Inner Primer PCR Length: 3098. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13B12.3 Homozygous. Outer Left Sequence: tgggctaaatgcgagtatcc. Outer Right Sequence: tcccacgagttagatgctca. Inner Left Sequence: tgaggaaattgttttcggga. Inner Right Sequence: ctcggtgaattggctcctac. Inner Primer PCR Length: 3098. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y73B6BL.7. Homozygous. Outer Left Sequence: GCGACGAAGAATGTTCAGGT. Outer Right Sequence: TTATGTCTTGGTGCGTCTCG. Inner Left Sequence: AGATTGATCGGCTTTGCACT. Inner Right Sequence: AGATGCCGACGTCAATTTTC. Inner Primer PCR Length: 3112 bp. Deletion Size: 1722 bp. Deletion left flank: TTTCCAAATTCATAGGAAAAATACTCTGAA. Deletion right flank: TTGCAAATTCTTGAAAGTAAAGTCAACTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W03G1.7 Homozygous. Outer Left Sequence: aagccagaattccgtgtttg. Outer Right Sequence: tcgtcctttctctcgcattt. Inner Left Sequence: cttgcactcctcctttccac. Inner Right Sequence: ggtgacagaatgcgaggaat. Inner Primer PCR Length: 3344. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R02D3.7 Homozygous. Outer Left Sequence: acccgttttcaacaaaacca. Outer Right Sequence: cagtggaattgatgacgtgg. Inner Left Sequence: ttcagccatcagcatacagc. Inner Right Sequence: tgacttttccgccatttttc. Inner Primer PCR Length: 2461. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y77E11A.10. Homozygous. Outer Left Sequence: TGCTTTCTAGGCCCACTTGT. Outer Right Sequence: CCTTGTTGGGTCATTTCCAC. Inner Left Sequence: TCGAAATTTGGACCTTCTCG. Inner Right Sequence: ATTTTCCAGCCAACAACTCG. Inner Primer PCR Length: 3274 bp. Deletion Size: 2386 bp. Deletion left flank: TTTTTTTGGGACGAAAAAATTCGCAAAAAA. Deletion right flank: GGATCCTTGTCTAACATCGAATCGGCTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F28E10.4. Homozygous. Outer Left Sequence: agtggacttctccaggggtt. Outer Right Sequence: ttagcgagttatcggctcgt. Inner Left Sequence: aaaaatgagcattgttcccg. Inner Right Sequence: aatttgttttcggcaactgg. Inner Primer PCR Length: 2105. Deletion Size: 1016. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W02A2.2. Homozygous. Outer Left Sequence: AGTTTGCCGAAAGAAAGCAA. Outer Right Sequence: AATGCCGGACAACAGGTAAG. Inner Left Sequence: AGCCAAGACTCGCCTAATCA. Inner Right Sequence: AGATCGGCAACCAATTCAAC. Inner Primer PCR Length: 2542 bp. Deletion Size: 1093 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15E6.6. Homozygous. Outer Left Sequence: tcctctcacaacatgccaaa. Outer Right Sequence: tcagtagcaacccgtaaccc. Inner Left Sequence: agtgctgcagtcaacaatgg. Inner Right Sequence: aaaatccagaaaccgtggtg. Inner Primer PCR Length: 3224. Deletion Size: 950. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y45F10B.6. Homozygous. Outer Left Sequence: GCAAATTGGAGATACCCGAA. Outer Right Sequence: CAACGTGTTTTGATGAACGG. Inner Left Sequence: CCCAAATCCCGAGAAGTACA. Inner Right Sequence: AATTCGGCATTGGAAAACAG. Inner Primer PCR Length: 2781 bp. Deletion Size: 746 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45E4.1, F45E4.7. Homozygous. Outer Left Sequence: CAAGGCAATCGTGAGTGAGA. Outer Right Sequence: TTGCATTCATTGAACCTCCA. Inner Left Sequence: AAGGAAAATGTTCGTGGTCG. Inner Right Sequence: GGATGCAAACCGACAGAGAT. Inner Primer PCR Length: 2145 bp. Deletion Size: 1065 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y62E10A.9. Homozygous. Outer Left Sequence: GACGACGATCGGTAGGAAAA. Outer Right Sequence: AGGAATGGATTTTTGTTGCG. Inner Left Sequence: GGCCGGGTCGAGTAATAAAT. Inner Right Sequence: TTCAACACTCTTGCCGTCTG. Inner Primer PCR Length: 2213 bp. Deletion Size: 1257 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C31H1.6. Homozygous. Outer Left Sequence: CCAAAGTCTCCTGCCCATTA. Outer Right Sequence: ACATACCACCCGCTTTCTTG. Inner Left Sequence: TTCAAACAATGATACCCGCA. Inner Right Sequence: TTTTGAGGGAAATGCGAAAC. Inner Primer PCR Length: 2666 bp. Deletion Size: 1117 bp. Deletion left flank: TATCAAAGTTTTTTTTTAATGAACTCTATA. Deletion right flank: AAAAGTAGTTTGAAGGTTTAAATTTGATTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08D12.2. Homozygous. Outer Left Sequence: AGTGGAATTTGTGGTCTCGC. Outer Right Sequence: AGAAGAGGGCTCGGAAAAAG. Inner Left Sequence: ATTTCGCTGCAAGACCTGTT. Inner Right Sequence: AGGTCGTTCTCGGACATCAC. Inner Primer PCR Length: 2681 bp. Deletion Size: 1137 bp. Deletion left flank: CCAGGACTCAACAATCCTGTACCTCTACCA. Deletion right flank: TCGAACTTCTTCACGCGATCTACAAGTCGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55G11.5. Homozygous. Outer Left Sequence: GGTCGAGCTCACACTTCTCC. Outer Right Sequence: AGCTGGTAAAAGCACTCCCA. Inner Left Sequence: GCTTTCCTGCGTCTTTTGAG. Inner Right Sequence: AAGGCAAGGCTGTATTCACG. Inner Primer PCR Length: 2425 bp. Deletion Size: 1426 bp. Deletion left flank: ATGGATCGGGATACATATTTTCAGACAATT. Deletion right flank: TGTGGTCAGTAGTGGAAAAGCTGATTTCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01F6.5. Homozygous. Outer Left Sequence: ATCTGTTGAGTGCGCAGTTG. Outer Right Sequence: GCGGAAACGAAGAAAGAGTG. Inner Left Sequence: TCAAATGTGTACGGGTGTGG. Inner Right Sequence: AACGTTCGCATCCCTAATTG. Inner Primer PCR Length: 2337 bp. Deletion Size: 1447 bp. Deletion left flank: TCGATCTATATGCATTAATTCATTCTATCA. Deletion right flank: ATTTTACTTGTTTGTTCTCATGTTTTCATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04G2.5. Homozygous. Outer Left Sequence: CCCATAGAGCCCTTGTGAAA. Outer Right Sequence: GGAGCAAAACAGCTTTCAGG. Inner Left Sequence: CCTTCACGAATCGCTTTCAT. Inner Right Sequence: CTCGATTGGAAGGTTCTTGC. Inner Primer PCR Length: 2140 bp. Deletion Size: 1471 bp. Deletion left flank: CTTCACGAATCGCTTTCATTAGTAATCCTT. Deletion right flank: AACTCACATTTATATCACAGAAACGATCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F41H10.11 Dpy animals. Homozygous. Outer Left Sequence: ttcccgagattcagatgtcc. Outer Right Sequence: gttggtggacgaggaaaaag. Inner Left Sequence: acctggtggatcagaagctg. Inner Right Sequence: cgggtagaataaaccgacga. Inner Primer PCR Length: 2236. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F08B4.2. Homozygous. Outer Left Sequence: TAGCAGCACGATATTGCCAG. Outer Right Sequence: CAAGAGCAACAGTTACCGCA. Inner Left Sequence: CAAGGCGTTTGGAGTGAAAT. Inner Right Sequence: AGGAATGGGAGATCGAACCT. Inner Primer PCR Length: 3244 bp. Deletion Size: 1695 bp. Deletion left flank: ATTGTATCCGACTGAAATTGCACCTGAAAA. Deletion right flank: CATCTGTGTCTGAAGCAGTCCGTCCTCCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y57G11C.20. Homozygous. Outer Left Sequence: ATACTCGAGCAGACTGGCGT. Outer Right Sequence: ATAATGTCACCAAGCCCAGC. Inner Left Sequence: AACCGTTTTACCCTGCACAC. Inner Right Sequence: AATCAACCCGGAAGACACTG. Inner Primer PCR Length: 2825 bp. Deletion Size: 1017 bp. Deletion left flank: TTCAGACTGATAAAGACGAACAGCGTGAGA. Deletion right flank: TTGATTTTTTAGATTCAAACATTTTATTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F52G2.1. Homozygous. Outer Left Sequence: GTGGCTCTGCCTGATTGATT. Outer Right Sequence: CGTTCCCAGATGTCGAAAAT. Inner Left Sequence: CTTTCGGAAATCCCCAATTT. Inner Right Sequence: TGGGAGCCATTTTCCTAGTG. Inner Primer PCR Length: 2796 bp. Deletion Size: 1603 bp. Deletion left flank: CATACATTTTTCCCCCTATTCATGTGTAGA. Deletion right flank: GTTTTTGTACACTTGATGGCGGCTCTTCTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C33H5.14. Homozygous. Outer Left Sequence: TTTCCTAATGTCGGGGTGAG. Outer Right Sequence: CAACGGTGAGCACTTCAAGA. Inner Left Sequence: GCCGAATTTGTTGCACTGTA. Inner Right Sequence: TGGAAAGCATGATGAACCAA. Inner Primer PCR Length: 3523 bp. Deletion Size: 2298 bp. Deletion left flank: TCCTAGAGCCCATTGCATTTCTTCACCGGC. Deletion right flank: TTAGATCTTCAATGAAATTGGTCAGAAAAA. Insertion Sequence: GTGATCTTCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y67D8C.10 Homozygous. Outer Left Sequence: ttctacggccattcttccac. Outer Right Sequence: tgacaaaacgggaacactca. Inner Left Sequence: gcttgaagctcgtctcatcc. Inner Right Sequence: gattcgtacttgcccttgga. Inner Primer PCR Length: 3172. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F56D6.15, Y46C8AL.3. Homozygous. Outer Left Sequence: GTTCACATTTTGGTTTGCCC. Outer Right Sequence: TCCATGTTTCAGGGTGCATA. Inner Left Sequence: CAGTTTGCCCGGACAGTAAT. Inner Right Sequence: ATCTTTGAACCCAGCACCTG. Inner Primer PCR Length: 2991 bp. Deletion Size: 4238 bp. Deletion left flank: TTTTTGCTTCACTTATTTCAAACCTCAAGT. Deletion right flank: GTAATAATTTCAGTCCATTGATATGATGCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K11H12.1. Homozygous. Outer Left Sequence: CCATGGGACAGACTGGAACT. Outer Right Sequence: CAAACCTACGGAAAGCCAAA. Inner Left Sequence: CTCGAGGGAAGCAGTGACTC. Inner Right Sequence: AGGATCCCAAGCCAAGAACT. Inner Primer PCR Length: 2167 bp. Deletion Size: 1116 bp. Deletion left flank: TACAACTAAAATCGAGCCGCGGCGCGCCGT. Deletion right flank: GAAAAATTGGTAAAGCCTATGAAAAAGTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C02F4.2. Homozygous. Outer Left Sequence: AGCCGAGCACAAGACAAAAT. Outer Right Sequence: AGTTTGGTTTCCGTTTCACG. Inner Left Sequence: ACCTTCAAAGGTGTCATCGC. Inner Right Sequence: CTATCTCCTTTTGCCCCCTC. Inner Primer PCR Length: 2766 bp. Deletion Size: 1069 bp. Deletion left flank: GTACTTCAGGATGGCAGCTGAAAATTGTTA. Deletion right flank: TAGCAGATTTTGAGTGCCCACAGATACAGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08E7.5. Homozygous. Outer Left Sequence: AAGGATGCACCAAACAAAGG. Outer Right Sequence: AGCGATTGAACAAATGACCC. Inner Left Sequence: CTTCAGCTTCACGTGGTTCA. Inner Right Sequence: CTGAGATTTGACGCTCCACA. Inner Primer PCR Length: 3141 bp. Deletion Size: 1298 bp. Deletion left flank: CAGGTACAAAGCCAAGCTCTTCAGCTTCAC. Deletion right flank: CCACGTAGCATTGAGCCCAGCAATTCGAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T13F2.8 Homozygous. Outer Left Sequence: cacgaagtgaacgaagcaaa. Outer Right Sequence: tccaacaagaccgggactac. Inner Left Sequence: ccatttcccatctgttaccg. Inner Right Sequence: tggatgaaagagcacacagc. Inner Primer PCR Length: 3302. Deletion Size: 2339 bp. Deletion left flank: AGAGTATCGTCCGTGAATCTTTAATCTAAA. Deletion right flank: ATTGTTGGAGTAAAAATCTAAAAATTTCGT. Deletion carries 626-bp insertion at break, corresponding to the reverse complement of T13F2 coordinates 8228-8854. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13B6.1. Homozygous. Outer Left Sequence: CCAGAATGACCATTCCGTTC. Outer Right Sequence: GGTGAACAGGCAAATCCACT. Inner Left Sequence: TTCACACCTGCTCAAATTGC. Inner Right Sequence: CTGTGGATCCGACAATCCTT. Inner Primer PCR Length: 2315 bp. Deletion Size: 1059 bp. Deletion left flank: ATCAAGTACTTAATGGATTCGTGGGATTAC. Deletion right flank: CATAATTCTCTTGCCACGTATGTAGCAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y77E11A.4. Homozygous. Outer Left Sequence: TGTTCACGGTGAGTGAGGAG. Outer Right Sequence: GTGGCCTGTGGCCTTAAATA. Inner Left Sequence: GTGGATAGGGCTGTGTCGAT. Inner Right Sequence: TGAGCGTCCTCCTCTCCTTA. Inner Primer PCR Length: 2335 bp. Deletion Size: 618 bp. Deletion left flank: TGCCGCAATTCTCATCGTGAGCTTCTTGTC. Deletion right flank: CATATCTGGGGTAGATTCACGGCGCGTCGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57H12.7. Homozygous. Outer Left Sequence: CACAATCTCCGCTCAAGACA. Outer Right Sequence: CTCGGAGCTTCCTACTGGTG. Inner Left Sequence: CGCAGCCGTTTTAATTTTGT. Inner Right Sequence: TTTTGAGGAATCGGGTGAAG. Inner Primer PCR Length: 2752 bp. Deletion Size: 1977 bp. Deletion left flank: TGGTACCCATCTCTCTCTCTCTCTCCGTCC. Deletion right flank: AATTTATTTTTAAAAAATTATATTCGGACC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C39E9.10. Homozygous. Outer Left Sequence: TCGAATCACTCACGCTCAAC. Outer Right Sequence: GTTGCAGGAGCTGAAGGACT. Inner Left Sequence: TGCCAGCTTATCTCTTGGCT. Inner Right Sequence: GTTGATGTTCGAATCGGCTT. Inner Primer PCR Length: 2992 bp. Deletion Size: 2469 bp. Deletion left flank: CGTAGTTCTGTTTTCTGTTTTTGTGATTTT. Deletion right flank: ACTTTGTGTCCTCACTCACGCTGGTCTCGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45E4.2. Homozygous. Outer Left Sequence: GAATTTTGCCGCGTATTTGT. Outer Right Sequence: GAATCCGCTCAATATCCGAA. Inner Left Sequence: GAAATTGCGTCTCGGTGTTT. Inner Right Sequence: TTATCCATCTCCATGGCTCC. Inner Primer PCR Length: 2124 bp. Deletion Size: 1107 bp. Deletion left flank: GCTTTTTTTCCTTTCTAAATCTTGTTTTTA. Deletion right flank: AAAAAATATATTAAAAACTTTTTTAATGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y45F10D.13. Homozygous. Outer Left Sequence: CCGAAAAATCAGCCCACTAA. Outer Right Sequence: AATTGCCGTTTCACAAGTCC. Inner Left Sequence: AATTTCAGCCCATCATCTGC. Inner Right Sequence: TACATCTCGGATCCTTTCGG. Inner Primer PCR Length: 2960 bp. Deletion Size: 1110 bp. Deletion left flank: TAAAACCCCAAAATCATCATTGAAAATAAA. Deletion right flank: AAATTGATTACTGTTTCAAAAAGTTATTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C27H2.2. Homozygous. Outer Left Sequence: TTCCGAATTGTTTGGCTTTC. Outer Right Sequence: TTTACAATCGCGTGTTGCTC. Inner Left Sequence: CAATTTCACCCTTCGATGCT. Inner Right Sequence: TTTGCCATTGTGCCAATAAA. Inner Primer PCR Length: 2901 bp. Deletion Size: 703 bp. Deletion left flank: ACTTTTTTCCGAATTTCGAATATTGTAAAA. Deletion right flank: GGCACCCTTCCGGCTCCGTCGAGCAAGAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

LLC1.1. Homozygous. Outer Left Sequence: TTGAGCACAACCTGAAGCAG. Outer Right Sequence: AAAACTCCTATTTGCCCGCT. Inner Left Sequence: TCACAGTTTTCGGGTTTTCC. Inner Right Sequence: AGATGTTTCCGGTGGAGTTG. Inner Primer PCR Length: 3226 bp. Deletion Size: 1474 bp. Deletion left flank: AAAGAACTGAAGTTATGTTTATTGGTTAAT. Deletion right flank: TCTCATTTTGAACTAGAAACTATTGCTAAC. Insertion Sequence: CTTCAGAAAAATATTACAAATTGTATCTTTTTACACAAGATTTTAAATTTTTAAAAATA AAATCTGAAACAATTTTGTCTAATAAAAACAAAGGCCCTCATGAATTGTTTATGAAAAT TATCACCCAAATAAGTTGATTAACTTGGGCGGGGCTTATTTTACAGGTTTTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01H12.2. Homozygous. Outer Left Sequence: TCCGTGATATGTTGTTCCGA. Outer Right Sequence: AGAGCCTGCCTACATGGCTA. Inner Left Sequence: TGTTTGCAAAATGATGCGAT. Inner Right Sequence: CAAGGTTCAGTTGCCTCCTC. Inner Primer PCR Length: 2111 bp. Deletion Size: 892 bp. Deletion left flank: ATCGACGATTCCTTTGTAACGTTTATCGGC. Deletion right flank: ATAATCGCAATCATTTTAAACCAAAAAGCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T21D12.9. Homozygous. Outer Left Sequence: CGCTTAGCACGAATACCTCG. Outer Right Sequence: GCTGGTCTTGCCTTTTTGAG. Inner Left Sequence: CACACGAGCTTGGTCACTTG. Inner Right Sequence: CCGTTTCCACACCATTCTCT. Inner Primer PCR Length: 2783 bp. Deletion Size: 906 bp. Deletion left flank: AATGGTCAACCTAGAGTTTTGGTACAGGAT. Deletion right flank: CTATCGTTTTAACTTTCAGAATTAATCTAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C33H5. Homozygous. Outer Left Sequence: AAGGAGAAAGTGGCAGCAAA. Outer Right Sequence: CAGACGGACCACCAGTACCT. Inner Left Sequence: CAATGCAGGCACAAGAAGAA. Inner Right Sequence: TCGCCTGGTCATATCAATCA. Inner Primer PCR Length: 2211 bp. Deletion Size: 1217 bp. Deletion left flank: ACTTGGAGTAAATTTTAAACTGCTATATTA. Deletion right flank: TTATCTGTCCTTGATATCCTTGATATGAGT. Insertion Sequence: TATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807