More Fields
Strain Species Genotype
RB1542 C. elegans C31H1.6(ok1852) IV. Show Description
C31H1.6. Homozygous. Outer Left Sequence: CCAAAGTCTCCTGCCCATTA. Outer Right Sequence: ACATACCACCCGCTTTCTTG. Inner Left Sequence: TTCAAACAATGATACCCGCA. Inner Right Sequence: TTTTGAGGGAAATGCGAAAC. Inner Primer PCR Length: 2666 bp. Deletion Size: 1117 bp. Deletion left flank: TATCAAAGTTTTTTTTTAATGAACTCTATA. Deletion right flank: AAAAGTAGTTTGAAGGTTTAAATTTGATTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2028 C. elegans lntl-1(ok1824) IV. Show Description
C31H1.6. External left primer: CCAAAGTCTCCTGCCCATTA. External right primer: ACATACCACCCGCTTTCTTG. Internal left primer: TTCAAACAATGATACCCGCA. Internal right primer: TTTTGAGGGAAATGCGAAAC. Internal WT amplicon: 2666 bp. Deletion size: 1550 bp. Deletion left flank: TTACAGGTCCATCAAAGCGGAATCCTTTAG. Deletion right flank: TTTTTGTTCAGGAAACTTTGAAACGCACAT. Insertion Sequence: TACGGACCTCGTTTGAATTTCAATCATCTTCATCAGCAACAACAGTTGCAGTGAGTTTT TGGGAAAATTTTTTTGAAAGTATAAATATTCGTTTTAGTTCAACAATCATTCCTTCGGA GTATCTCGGAGACAAGTCAGGATTTGAGTCCAGGTAAGGGATGAAGAAGGCAATTCCAA AAAATTTTTAAACAAAAAACGACTGTTTCACGGTGCTATTATAACAAAACCATATGAAT GTGATTTGGTTCGAACCATGCCTTTGCCATTTTTAAAACATCATTATAAATAGTTCTGC AAATTAATATTACAGAACTCTTCCATCGGAATCTATTATGTCAGCCAACAGCAGCAGTC TTGGATCTCACTGGAAGAGAATTGATTCGTTCACTAGTGGAAAATCTACCCAATCAATT CCCACTACAATTTCTTCGAAACCTCTAACTATTCCTTCATCGATTTCTGCCAACACCGC TTCCATCCCACCAAATCATGGTTCAGAATTTTCGAAAGATTTCAAGATGTCATCCTCAT CGAGCATGACTAGTGAGTATTCGGAAACCATCCATGGAAACTCGTTGGCATCTCTGGCT CCATCGTCACAAATATTGAGCTCTTTGGTTGAAACTACTGAGAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807