Search Strains

C42D4.9 Homozygous. Outer Left Sequence: tgtaacacggcaggttcaaa. Outer Right Sequence: acattccgttttccatttgc. Inner Left Sequence: ttggcgccacttcttcttta. Inner Right Sequence: ccagactgtccaaaatccaga. Inner Primer PCR Length: 1146. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R11E3.4 Homozygous. Outer Left Sequence: gatgtttgaaaggcttggga. Outer Right Sequence: cggtgaaactcacaggacaa. Inner Left Sequence: tcattaacatgagctactcgtcg. Inner Right Sequence: gctttccttgtgcctacacc. Inner Primer PCR Length: 1178. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06E7.3 Homozygous. Outer Left Sequence: gtgggggctactgattttga. Outer Right Sequence: gttctcgtccgaaacgtcat. Inner Left Sequence: agctggtccttgtgatttgg. Inner Right Sequence: acgatgattcctcgaaaggt. Inner Primer PCR Length: 1141. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R11A8.5 Homozygous. Outer Left Sequence: gccaccattcagcaattttt. Outer Right Sequence: accgatccgttgtgtttttc. Inner Left Sequence: tgaacgctgagcatccatag. Inner Right Sequence: cgcccgttttcttttaatg. Inner Primer PCR Length: 1218. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08E4.2 Homozygous. Outer Left Sequence: aactccaatgaaaccgcaac. Outer Right Sequence: ttttctctgtgccctccagt. Inner Left Sequence: ctgcaaaatgcatagcgaaa. Inner Right Sequence: tgtttgttctgatacatggcaa. Inner Primer PCR Length: 1164. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C49C8.5 Homozygous. Outer Left Sequence: ttttgtgcctacccgtatcc. Outer Right Sequence: tatggccaattttcagaccc. Inner Left Sequence: gccgttgtcatcatcgtaaa. Inner Right Sequence: ttttgttactgttccagggctt. Inner Primer PCR Length: 1200. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C42D4.9 Homozygous. Outer Left Sequence: tgtaacacggcaggttcaaa. Outer Right Sequence: acattccgttttccatttgc. Inner Left Sequence: ttggcgccacttcttcttta. Inner Right Sequence:ccagactgtccaaaatccaga . Inner Primer PCR Length: 1146. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44D12.3 Homozygous. Outer Left Sequence: acaaataattctgcgggacg. Outer Right Sequence: acctcttccacgtcttctcg. Inner Left Sequence: tcttcaaaaactcgctgtgg. Inner Right Sequence: cacgaaaggtcactggttca. Inner Primer PCR Length: 1142. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F28D1.2 Homozygous. Outer Left Sequence: cctcttctccctcctcatca. Outer Right Sequence: tcatttcactcgcacaggtc. Inner Left Sequence: ttcaacctcgtagttctcctcc. Inner Right Sequence: cgactggttgtcaccctttt. Inner Primer PCR Length: 1189. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R08C7.12 Homozygous. Outer Left Sequence: aaacttccggcaaattgatg. Outer Right Sequence: aggcttaggcttaggcttgg. Inner Left Sequence: acggcagagttggcaattt. Inner Right Sequence: cagtcattctttgcgcttca. Inner Primer PCR Length: 1119. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y41D4B.10 Homozygous. Outer Left Sequence: gcaaattcggcaaatctctt. Outer Right Sequence: atacccctttccaaaaaccg. Inner Left Sequence: ttgccgtgcttaacaaactc. Inner Right Sequence: atgaagtcacaggtgacaaaaa. Inner Primer PCR Length: 1353. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W02C12.1 Homozygous. Outer Left Sequence: gaaaacctctgcgcatcttc. Outer Right Sequence: gtcttggactgccaggtgat. Inner Left Sequence: gtgttcacggactgtgcatc. Inner Right Sequence: atgcaaagaaaagaatgccg. Inner Primer PCR Length: 1156. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y11D7A.4 Homozygous. Outer Left Sequence: tatgaggcgtctgattgctg. Outer Right Sequence: ggccatggatggagagtaaa. Inner Left Sequence: cgatgaactgaccttaggctg. Inner Right Sequence: ggagatggagcaagtggaaa. Inner Primer PCR Length: 1145. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y9C9A.16 Homozygous. Outer Left Sequence: gtcgacagttttcaagtgcg. Outer Right Sequence: ctcgaaaacttccaagtggc. Inner Left Sequence: tgatgcagctgtttttgcat. Inner Right Sequence: tgtcggtggaggtctaatga. Inner Primer PCR Length: 1187. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F58G6.1 Homozygous. Outer Left Sequence: tttgataaacgctgttggca. Outer Right Sequence: ttcattgcacttttcccctc. Inner Left Sequence: cgaagaatgtgatacgactgtca. Inner Right Sequence: cgcattttcttcattcggtt. Inner Primer PCR Length: 1279. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C52D10.7 Homozygous. Outer Left Sequence: cgattgttgaacggcttttt. Outer Right Sequence: aagtcgaagagcacgtcgtt. Inner Left Sequence: acaactccatcgctcgaaat. Inner Right Sequence: gaagttggtatcccattcgg. Inner Primer PCR Length: 1354. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F37C4.5 Homozygous. Outer Left Sequence: tctgtggatcttggcaactg. Outer Right Sequence: ttttcagaacctcccattcg. Inner Left Sequence: atggtgagaagcaccgagtt. Inner Right Sequence: tctcgcaattaaggcgatct. Inner Primer PCR Length: 1166. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y45F10A.5 Homozygous. Outer Left Sequence: agcttccggtcaggttcttt. Outer Right Sequence: aaaaggtgaacgatgaacgg. Inner Left Sequence: aaccaccacatttttggtaaaga. Inner Right Sequence: agggggtgacgtttttgagt. Inner Primer PCR Length: 1236. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54G2A.11 Homozygous. Outer Left Sequence: gctgaaaattgctctcaccc. Outer Right Sequence: aactttttagctccgcctcc. Inner Left Sequence: catttgatagccgcctcaat. Inner Right Sequence: ttttctcaacacggtttctcaa. Inner Primer PCR Length: 1129. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y67D8C.8 Homozygous. Outer Left Sequence: acgtgtcgtcatagtgtccg. Outer Right Sequence: ttttgtcgcaaattgaccag. Inner Left Sequence: tatttggcacgcttttcaga. Inner Right Sequence: cgaaagtcagaattgacaacattt. Inner Primer PCR Length: 1283. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W08D2.5 Homozygous. Outer Left Sequence: cttaaaatttcgcggctgag. Outer Right Sequence: taaggccttccaaaagagca. Inner Left Sequence: ttttcggcttagaaaacagca. Inner Right Sequence: tggtgagctcgatgaatacg. Inner Primer PCR Length: 1324. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06A6.3 Homozygous. Outer Left Sequence: tttttgtttccgctcaaggt. Outer Right Sequence: ggtctcgacacgaccaactt. Inner Left Sequence: tatttgtcatttgaccgccc. Inner Right Sequence: ctaagtaggcatgcgccttt. Inner Primer PCR Length: 1233. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13B12.4 Homozygous. Outer Left Sequence: gcgtcgactggtcaattttt. Outer Right Sequence: tcttcgcaatgcaaaagcta. Inner Left Sequence: agcaagcacaaaactcatgc. Inner Right Sequence: cgacaaaaaccacggattcta. Inner Primer PCR Length: 1126. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15B10.2 Homozygous. Outer Left Sequence: tcaccgatccagttgcatta. Outer Right Sequence: aacccaacagtatccctcca. Inner Left Sequence: taatgcttgttgctcatccg. Inner Right Sequence: acacgcaacgcagttttatt. Inner Primer PCR Length: 1136. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M4.2 Homozygous. Outer Left Sequence: ttggtcctgaaggaatcgac. Outer Right Sequence: cgagtattctgagcatgcga. Inner Left Sequence: aggttacggtatctgccacg. Inner Right Sequence: caccgaacattgaaacatgg. Inner Primer PCR Length: 1306. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y55D9A.1 Homozygous. Outer Left Sequence: tttgccgtcgagtttttagc. Outer Right Sequence: tggacgcaaaggatatgtca. Inner Left Sequence: tttgtagtgaaatcgcattatctttt. Inner Right Sequence: agcaaagtttcaggtcaccg. Inner Primer PCR Length: 1305. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C07G1.8 Homozygous. Outer Left Sequence: acggcggaagagtgagaata. Outer Right Sequence: caccatcaacagcaacaacc. Inner Left Sequence: cgatggaaaaggacaaaagtc. Inner Right Sequence: aaattgccgaacaaccactt. Inner Primer PCR Length: 1398. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y45F10B.10 Homozygous. Outer Left Sequence: gcagcaggcataaagtaggc. Outer Right Sequence: aatagccaacgtgctaaccg. Inner Left Sequence: tctcgcagggtataaaacgg. Inner Right Sequence: gagccatcaatcctcccat. Inner Primer PCR Length: 1127. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C25G4.6 Homozygous. Outer Left Sequence: gtcttttgaatcgccaaagc. Outer Right Sequence: ggtggagcaaagcaagttgt. Inner Left Sequence: gaaccacttggtgcaactcc. Inner Right Sequence: agaggctcagtgttgtgggt. Inner Primer PCR Length: 1285. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C52D10.11 Homozygous. Outer Left Sequence: ggaaaattcacgaactggga. Outer Right Sequence: gtgccgactgaaagaagagc. Inner Left Sequence: cagggggttgtgaatttttg. Inner Right Sequence: ttttgcaagatggtgagtcg. Inner Primer PCR Length: 1301. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C52D10.11 Homozygous. Outer Left Sequence: ggaaaattcacgaactggga. Outer Right Sequence: gtgccgactgaaagaagagc. Inner Left Sequence: cagggggttgtgaatttttg. Inner Right Sequence: ttttgcaagatggtgagtcg. Inner Primer PCR Length: 1301. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01G10.1 Homozygous. Outer Left Sequence: gtggacatcccacgtcttct. Outer Right Sequence: ttgctcctgggatagtacgg. Inner Left Sequence: aagtacgatgtcgcagagcc. Inner Right Sequence: caattgagactccgacgtga. Inner Primer PCR Length: 1147. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T12E12.6 Homozygous. Outer Left Sequence: agatgagaaacggagagcca. Outer Right Sequence: ggggatttcttcgaatcaga. Inner Left Sequence: cgtacaacttgagcaaaaagtga. Inner Right Sequence: tgttttacccacgtaaaatgga. Inner Primer PCR Length: 1203. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y62E10A.12 Homozygous. Outer Left Sequence: actatgtgagccctgaacgg. Outer Right Sequence: gagatttttcaaacggcgaa. Inner Left Sequence: ggctggaaagtgaattgagc. Inner Right Sequence: cagccatgtgtcgatttatga. Inner Primer PCR Length: 1360. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01G10.8 Homozygous. Outer Left Sequence:ccaaccgacttccttgttgt . Outer Right Sequence: attcgttcatcagccacctc. Inner Left Sequence: ggctgcggggaattatatgt. Inner Right Sequence: tccgagagccaatgttttct. Inner Primer PCR Length: 1192. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06A12.4 Homozygous. Outer Left Sequence: tcgccttgtttactgcctct. Outer Right Sequence: cgctactgcgaacgagtttt. Inner Left Sequence: ctggttggcagttttccagt. Inner Right Sequence: aaacgtttttgttccctttgaa. Inner Primer PCR Length: 1277. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y105C5B.12 Homozygous. Outer Left Sequence: cattgtgtccaaagtgtccg. Outer Right Sequence: ctgatttctggctctacggg. Inner Left Sequence: gcggttggttcataaattgg. Inner Right Sequence: ggtgagatcacctcgaaagc. Inner Primer PCR Length: 1118. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C55C3.3. Homozygous. Outer Left Sequence: tgaatcggaaaaatcgaagg. Outer Right Sequence: gatctaccaagaatgcggga. Inner Left Sequence: caggtctcgccacgatttat. Inner Right Sequence: tttgtctgggcgaaaaattc. Inner primer WT PCR product: 3283. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C33D9.1a. Homozygous. Outer Left Sequence: taccttttggttgtgtgcca. Outer Right Sequence: caattaccgtcccaaccatc. Inner Left Sequence: ccaatagttgcggaaggaaa. Inner Right Sequence: attggactttgatgcggttc. Inner primer WT PCR product: 3388. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23B2.1. 10/03: Not homozygous (Mark Edgley). Outer Left Sequence: tttctttctcaccccgaatg. Outer Right Sequence: tcgttcacttggatgctctg. Inner Left Sequence: tggcaaggtgtgcaaataaa. Inner Right Sequence: catgtggattcaatggtgga. Inner primer WT PCR product: 2392. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08C7.6. Homozygous. Outer Left Sequence: CTTATGCAGAGCATCACGGA. Outer Right Sequence: GCATATTTTAGCCATGCCGT. Inner Left Sequence: ATGGCGTTCTTGTCTGCTCT. Inner Right Sequence: AATTTTCCAATTTTTCGGGC. Inner primer WT PCR product: 2965. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F12F6.5. Homozygous. Outer Left Sequence: GATGTGAAGGCTGACAAGCA. Outer Right Sequence: TAACCCGTGCATTTGTTGAA. Inner Left Sequence: CTTCGAGGCCAATCATCAAT. Inner Right Sequence: GCCAAAACTATCATGGGCTG. Inner Primer PCR Length: 2904 bp. Deletion Size: 1406 bp. Deletion left flank: ttttattactttgttttatatttcaaaaac. Deletion right flank: atcaagtcgatcttcaaatcgatcaaaagc. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F28F9.1. 7/03: Not homozygous (Mark Edgley). Outer Left Sequence: CTCCTCCCTGTCTCTCGTTG. Outer Right Sequence: TGAAGGAAAAAGCGAAGCAT. Inner Left Sequence: TGGCGAGGAAATTAAGTTGG. Inner Right Sequence: AGACGTTTATTGGCACAGCC. Inner primer WT PCR product: 2791. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M01D7.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C54E4.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C43F9.6. Homozygous. Outer Left Sequence: cggtgctgcattgtgtctat. Outer Right Sequence: tcgtactgcttgtttgcgtc. Inner Left Sequence: aaatcgttcgaaattgtggg. Inner Right Sequence: tctcgacagacggtgagttg. Inner primer WT PCR product: 2548. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08F4.8. Homozygous. Outer Left Sequence: atgctgggtgaaactaacgg. Outer Right Sequence: caaaagcatcgcagaaaaca. Inner Left Sequence: ctggaagttgtccagatggc. Inner Right Sequence: tccggtgtgaaatgtaacga. Inner primer WT PCR product: 2582. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK829.10. Homozygous. Outer Left Sequence: CACGTGTAAGCTCGACTCCA. Outer Right Sequence: ACATTGAACAATGCGGAACA. Inner Left Sequence: GGCCCACTCTTTAATACGCA. Inner Right Sequence: GAACTTGCCCCCACATCTAA. Inner primer WT PCR product: 3546. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0273.2. Homozygous. Outer Left Sequence: cagattttgagccaagctcc. Outer Right Sequence: gtgaacttctcgaagacggc. Inner Left Sequence: aatcattttcccgtccgttt. Inner Right Sequence: tccagtggatagttggcct. Inner primer WT PCR product: 3185. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08C7.2. Homozygous. Outer Left Sequence: GAACAAAGGATGTCGGAGGA. Outer Right Sequence: TCGCAGCATTTTCTTTTGTG. Inner Left Sequence: ACATCAAAGGAAATGACGGC. Inner Right Sequence: CCGATCACACCAGGAAAAAT. Inner primer WT PCR product: 2403. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807