Strain Information

Name RB1728   View On Wormbase
Species C. elegans
Genotypetra-3(ok2207) IV.
DescriptionLLC1.1. Homozygous. Outer Left Sequence: TTGAGCACAACCTGAAGCAG. Outer Right Sequence: AAAACTCCTATTTGCCCGCT. Inner Left Sequence: TCACAGTTTTCGGGTTTTCC. Inner Right Sequence: AGATGTTTCCGGTGGAGTTG. Inner Primer PCR Length: 3226 bp. Deletion Size: 1474 bp. Deletion left flank: AAAGAACTGAAGTTATGTTTATTGGTTAAT. Deletion right flank: TCTCATTTTGAACTAGAAACTATTGCTAAC. Insertion Sequence: CTTCAGAAAAATATTACAAATTGTATCTTTTTACACAAGATTTTAAATTTTTAAAAATA AAATCTGAAACAATTTTGTCTAATAAAAACAAAGGCCCTCATGAATTGTTTATGAAAAT TATCACCCAAATAAGTTGATTAACTTGGGCGGGGCTTATTTTACAGGTTTTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
Made byOMRF Knockout Group
Laboratory RB
Sign in or register an account if you want to order this strain.