Search Strains

More Fields
Strain Species Genotype Add
ZF1222 C. sp. 25 Show Description
Isolated by Adeline Seah and Takao Inoue from a rotten fruit in an urban garden in Singapore (1.45°N, 103.72°E) on 7/19/2007.
ZG119 C. elegans unc-119(ed3) III; iaIs7 IV; vhl-1(ok161) X. Show Description
iaIs7 [nhr-57p::GFP + unc-119(+)] IV. Over-expression of nhr-57:GFP in vhl-1 mutant background. Reference: Shen C, et al. Genetics. 2006 Nov;174(3):1205-14.
ZG120 C. elegans unc-119(ed3) III; iaIs7 IV. Show Description
iaIs7 [nhr-57p::GFP + unc-119(+)] IV. GFP expression is very weak. Reference: Shen C, et al. Genetics. 2006 Nov;174(3):1205-14.
ZG24 C. elegans ahr-1(ia3) I. Show Description
Homozygous viable with neuronal defects.
ZG443 C. elegans iaIs7 IV; egl-9(ia58) V. Show Description
iaIs7 contains [nhr-57p::GFP + unc-119(+)]. Egl. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).
ZG444 C. elegans iaIs7 IV; egl-9(gk277) V. Show Description
iaIs7 contains [nhr-57p::GFP + unc-119(+)]. nhr-57p::GFP is expressed at low levels. Superficially wild-type. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).
ZG448 C. elegans iaIs7 IV; egl-9(ia60) V. Show Description
iaIs7 contains [nhr-57p::GFP + unc-119(+)]. Egl. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).
ZG449 C. elegans iaIs7 IV; egl-9(ia61) V. Show Description
iaIs7 contains [nhr-57p::GFP + unc-119(+)]. ia61 was induced by Mos1 mutagenesis. Egl. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).
ZG492 C. elegans iaIs7 IV; egl-9(ok478) V. Show Description
iaIs7 contains [nhr-57p::GFP + unc-119(+)]. Egl. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).
ZG494 C. elegans unc-119(ed3) III; egl-9(sa307) V; iaIs38. Show Description
iaIs38 contains [egl-9p::egl-9::tag + unc-119(+)]. Superficially WT. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).
ZG580 C. elegans unc-119(ed3) III; iaIs28. Show Description
iaIs28 contains [hif-1p::hif-1a::tag + unc-119(+)]. Published in Zhang et al PLoS ONE 4: e6348 (2009).
ZG583 C. elegans iaIs34. Show Description
iaIs34 contains [hif-1p::hif-1a (P621G)::tag + unc-119(+)]. Published in Zhang et al PLoS ONE 4: e6348 (2009).
ZG596 C. elegans hif-1(ia7) V. Show Description
Published in Zhang et al PLoS ONE 4: e6348 (2009).
ZG601 C. elegans iaIs21. Show Description
iaIs21 [gcy-35p::GFP + unc-119(+)]. gcy-35::GFP is expressed in fifteen neurons, all of which also express ahr-1: AQR, PQR, URXR/L, ALNL/R, BDUL/R, SDQL/R, PLML/R, AVM, and two neurons in the tail tentatively identified as PLNL/R. gcy-35::GFP is only transiently expressed in PLML/R during the first larval stage.
ZG610 C. elegans iaIs25. Show Description
iaIs25 [gcy-37p::GFP + unc-119(+)]. gcy-37::GFP is consistently expressed in AQR, PQR, URXL. and URXR neurons. Expression also observed in AVM and two unidentified neurons located in the head.
ZG611 C. elegans iaIs19. Show Description
iaIs19 [gcy-32p::GFP + unc-119(+)]. Expression of gcy-32::GFP is consistenly observed in AQR, PQR, and URX neurons.
ZG629 C. elegans iaIs22. Show Description
iaIs22 [gcy-36p::GFP + unc-119(+)]. gcy-36::GFP is consistently expressed in AQR, PQR, URXL and URXR neurons.
ZG686 C. elegans unc-119(ed3) III; egl-9(sa307) V; iaEx101. Show Description
iaEx101 contains [egl-9p::egl-9(H487A)::tag + unc-119(+)]. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).
ZH1963 C. elegans enIs59 I; unc-76(e911) V. Show Description
enIs59 [ced-1p::2xFYVE::GFP + unc-76(+)] I. ced-1p::2xFYVE::GFP is a phosphainositol PtdIns(3)P reporter expressed in engulfing cells for assaying cell corpse clearance and other membrane trafficking events. GFP expression from enIs59 is relatively low and causes the least deleterious effects to worm development. Reference: Lu N, et al. PLoS Biol. 2012 Jan;10(1):e1001245. PMID: 22272187
ZH231 C. elegans enIs7 X. Show Description
enIs7 [ced-1p::ced-1::GFP + unc-76(+)] X. GFP marker for cell corpses. Reference: Lu N, et al. Methods Mol Biol 2009;559, 357-370. PMID: 19609769
ZH382 C. elegans unc-108(n3263) I. Show Description
Recessive Unc. Recessive apoptotic cell removal defect. Recessive phagosome maturation defect (inefficient and prolonged phagosome maturation process in embryos). Reference: Mangahas PM, Yu X, and Zhou Z. J Cell Biol. 2008 Jan 28;180(2):357-73.
ZM10113 C. elegans twk-40(bln282[twk-40::TagRFP::ZF1]) III; hpIs727. Show Description
hpIs727 [rig-3p::zif-1::sl2::RFP + ttx-3p::GFP]. twk-40(bln282) is a CRISPR generated allele of the endogenous twk-40 locus, inserting TagRFP and ZF1 allowing visualization of endogenous protein expression and localization as well as ZIF-1-mediated degradation. hpIs727 provides AVA neuron-specific expression of ZIF-1, leading to depletion of TWK-40 from AVA. Animals have loopy forward and reversal movements compared to twk-40(bln282) alone.
ZM10176 C. elegans unc-25(e156) III; hpIs593; ljIs131. Show Description
hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. D motor neurons are marked with red fluorescence. No behavioral change upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10311 C. elegans unc-25(e156) III; ljIs131; hpIs758. Show Description
ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40(s)p::Cre + myo-2p::wCherry]. Pick animals with red fluorescence to maintain. Shrinker. RFP expression in AVA and a few other neurons. Reversal upon green light illumination with ATR. hpIs758 is a spontaneous insertion of hpEx4080. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10339 C. elegans hpIs717; ljIs131. Show Description
hpIs717 [acr-2(s)p::LoxP::eBFP::LoxP::Chrimson::wCherry + unc-17p::Cre + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Red fluorescence in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10355 C.elegans twk-40(bln282[twk-40::TagRFP::ZF1]) III; hpEx4120. Show Description
hpEx4120 [rgef-1p::GPI::YFP]. Pick YFP+ animals to maintain. TagRFP::ZF1 tag inserted into endogenous twk-40 locus.
ZM10393 C. elegans hpIs592; hpIs595. Show Description
hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. hpIs595 [acr-2(s)p::GCaMP6s::wCherry + lin-15(+)]. Body relaxation upon green light illumination with ATR. Red fluorescence in D motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10441 C. elegans unc-49(e407) III; hpIs592; ljIs131. Show Description
hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Body relaxation upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10484 C. elegans unc-25(e156) III; hpIs321; hpIs331; ljIs131. Show Description
hpIs321 [nmr-1p::miniSOG::UrSL2::wCherry + lin-15(+)]. hpIs331 [lgc-55p::miniSOG::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Dorsal-coiler in L1, kinker in Adult after 1 hr illumination with blue light. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10538 C. elegans hpIs774; hpEx4081. Show Description
hpIs774 [twk-40p(short)::GCaMP6s::mNeptune]. hpEx4081 [rig-3p::LoxP::eBFP::Stop::LoxP::gtACR2::wCherry + twk-40p(short)::Cre + myo-2p::RFP]. Pick RFP+ (pharynx) to maintain. Transgenic animals are GFP and RFP positive in multiple neurons in the head, but strong RFP signals in AVA neurite. Superficially wild type. Activation of gtACR2 decreases AVA and AVB’s calcium signals. hpEx4081 can be maintained by picking animals with weak pharyngeal RFP signals (seems to be a common artifact of the Cre-LoxP system).
ZM10755 C. elegans hpIs814. Show Description
hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA. Slow forward and backward movement, with reduced reversals.
ZM1079 C. elegans unc-77(hp102) IV. Show Description
Hyperactive coiler. hp102 is a gain-of-function mutation. Reference: Yeh E, et al. PLoS Biol. 2008 Mar 11;6(3):e55. doi: 10.1371/journal.pbio.0060055. PMID: 18336069.
ZM10806 C. elegans hpIs824. Show Description
hpIs824 [flp-18p::LoxP::eBFP::Stop::LoxP::gtACR2::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA soma and neurites of the VNC. Activation of gtACR2 inhibits both forward and backward movement.
ZM11082 C. elegans twk-40(hp834) III; hpIs814. Show Description
hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA. twk-40(hp834) is a loss-of-function allele. twk-40(hp834) itself is highly loopy and a weak backward coiler. The presence of hpIs814 in the background reduces body bending and speed compared to twk-40(hp834) alone.
ZM11085 C. elegans hpIs814; hpEx4363. Show Description
hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. hpEx4363 [npr-4p::ins-22::pHluorin + myo-2p::wCherry]. Pick wCherry+ (pharynx) animals to maintain. Red fluorescence in AVA.
ZM11086 C. elegans hpEx4362. Show Description
hpEx4362 [flp-18p::cha-1(sense) + twk-40p::cha-1(antisense) + ttx-3p::GFP]. Pick animals with GFP expression in AIY to maintain. Transgenic animals exhibit reduced forward speed and body bending; this phenotype is not fully penetrate.
ZM11151 C. elegans hpIs758; hpIs814. Show Description
hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40p(short)::Cre + myo-2p::wCherry]. hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. RFP positive in AVA soma and neurite along the VNC. Weak pharyngeal RFP. Flat and slow movement without ATR or LED stimulation. Chrimson activation induces loopy reversal but not loopy forward after 5min.
ZM1344 C. elegans hpIs61 II. Show Description
hpIs61 [unc-25p::unc-10::GFP]. hpIs61 maps to LG II.
ZM2246 C. elegans hpIs88. Show Description
hpIs88 [unc-25p::mCherry::unc-10 + lin-15(+)]. mCherry is fused to the N-terminus of UNC-10. Weak RFP expression in nerve ring, small and round RFP puncta on both ventral and dorsal nerve cord. Reference: Hung W, et al. Development. 2007 Jan;134(2):237-49.
ZM3087 C. elegans unc-9(fc16) unc-7(e5) X. Show Description
Kinkers. References: Yeh E, et al. J Neurosci. 2009 Apr 22;29(16):5207-17. Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86.
ZM3360 C. elegans unc-77(hp102) IV; unc-80(hp369) V. Show Description
Fainter. hp369 is an early nonsense mutation in unc-80 and was isolated as a suppressor of unc-77(hp102). Reference: Yeh E, et al. PLoS Biol. 2008 Mar 11;6(3):e55. doi: 10.1371/journal.pbio.0060055. PMID: 18336069.
ZM4624 C. elegans hpIs166. Show Description
hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. Reference: Gao S, et al. 2015. Nature Communications 6, Article number: 6323.
ZM4864 C. elegans daf-2(e1370) III; oxIs22. Show Description
oxIs22 [unc-49p::unc-49::GFP + lin-15(+)]. Temperature-sensitive Daf-c. GFP punctae are relatively normal in dauers. Maintain at 15C. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.
ZM4898 C. elegans hpIs171. Show Description
hpIs171 [acr-2p::D3cpv + lin-15(+)]. Strong fluorescent marker for motor neuron Ca2+ imaging (FRET). Reference: Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86. PMID: 22099460
ZM5101 C. elegans hpIs193. Show Description
hpIs193 [nlf-1p::nlf-1::GFP + lin-15(+)]. GFP expression in head and tail neurons, as well as along ventral cord. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043
ZM54 C. elegans hpIs3 X. Show Description
hpIs3 [unc-25p::syd-2::GFP] X. GFP is expressed in small puncta along ventral and dorsal cords; bright perinuclear staining in DD and VD cell bodies. hpIs3/+ and hpIs3 males have reduced GFP levels in cell bodies. Reference: Yeh E, et al. J Neurosci. 2005 Apr 13;25(15):3833-41.
ZM5488 C. elegans hpIs202. Show Description
hpIs202 [ceh-10p::GFP + lin-15(+)]. GFP is expressed by four neurons RID, AIY, CAN, ALA, and one sheath cell. References: Wang et al., 2015. Development 142(8):1447-57. doi: 10.1242/dev.119479. Lim et al., 2016. Elife 5. pii: e19887. doi: 10.7554/eLife.19887.
ZM607 C. elegans syd-2(ok217) X. Show Description
Egl. Backward stiff and slow moving. Sluggish. Can move fast when poked. Outer pairs: F59F5.6EL1 (TTGCATCTGCAAAAGAAACG); F59F5.6ER1 (GCTCCGAACGAAAGAAGTTG). Inner pairs: F59F5.6IL1 (AATCTCTAACCATGCGGTCG); F59F5.6IR1 (CGCGGGAATTATGCCTATTA).
ZM6523 C. elegans hpDf761 II; unc-119(ed3) III. Show Description
hpDf761 removes ins-4, ins-5, and ins-6. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.
ZM6610 C. elegans nlf-1(hp428) X. Show Description
Fainter. hp428 is a G to A substitution that alters the 3? splice junction of the first intron resulting in a single base pair deletion in the hp428 cDNA causing a frame-shift and premature stop. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. doi: 10.1016/j.neuron.2013.01.018. PMID: 23522043.