Search Strains

C11E4.4. Superficially wild type. External left primer: AGTTGGTCGTTAGGTGACCG. External right primer: GTGTGACCTCCGAAGACCTC. Internal left primer: TTTTGGACCATTGTGGTTGA. Internal right primer: ACGCTCGTTCCTCTCAAGAA. Internal WT amplicon: 2244 bp. Deletion size: 1158 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y73B6BL.21. Superficially wild type. External left primer: TTACCCCGATGACTCACTCC. External right primer: AACCAAGCGGAACATTTTTG. Internal left primer: GCAAGTTGGCTCAAATCTCC. Internal right primer: CACTGGTGGCTCATCTTTCA. Internal WT amplicon: 1651 bp. Deletion size: 1261 bp. Deletion left flank: TTAGCGGGCTGCATTGGTTTTATACACATA. Deletion right flank: ATCTTCATAAATTTTCACAATTTATGCACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04A2.3. External left primer: TCGAGTTGGGCTCAGTCTTT. External right primer: CAGCGATGATGATGAAGGAA. Internal left primer: GGTAAAAGCTGCCAATCCAA. Internal right primer: CTTGTCCTCACTCCGCTCTC. Internal WT amplicon: 2523 bp. Deletion size: 1747 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T28B8.2. Superficially wild type. External left primer: TTCAGATTGCTCGAAAGGCT. External right primer: GCCATTGTATCCATCCCATC. Internal left primer: CGTCGCCACTATTCCAAAAT. Internal right primer: CGTATTTTGTGGGCGGTACT. Internal WT amplicon: 2143 bp. Deletion size: 940 bp. Deletion left flank: AAGCTGGTTTGTTTTCATGTTTGTAATACA. Deletion right flank: TTTGGCAATTGGCAATTATTTAATTCTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F34D6.4. Superficially wild type. External left primer: CTACTGCCAGAGAAGGCGAC. External right primer: AACCCTAACGTATCCCCACC. Internal left primer: TACATTCCGACGACTTGCAG. Internal right primer: CCCACAGTAACCCCACAGTC. Internal WT amplicon: 3166 bp. Deletion size: 1731 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17C3.7. Superficially wild type. External left primer: TTTCCATCTCAGCGTGTGAC. External right primer: ACATCCTGTCCCAGCTTCAC. Internal left primer: AGCAAACCGGAGTTCTCAAA. Internal right primer: AGAATGGGACATCCCACAAA. Internal WT amplicon: 2113 bp. Deletion size: 1550 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K05B2.3. Superficially wild type. External left primer: ATGTTTCACTTTGGCGGTTC. External right primer: AGAGCGAATACCGAAGCTCA. Internal left primer: CGAGAGTAATTCCGGGTTCA. Internal right primer: TCGCAAGATGGAGAAGGACT. Internal WT amplicon: 2608 bp. Deletion size: 894 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H21P03.1. Superficially wild type. External left primer: CAGGCATCATCCAATGACAG. External right primer: TGCACTTTTCTCCTCTCGGT. Internal left primer: TGCATATCCCAACATTCCAA. Internal right primer: TCTTTGCTAACCGGCTGTCT. Internal WT amplicon: 1923 bp. Deletion size: 1428 bp. Deletion left flank: AATCATGTCACAGTCATGGATTTAAAATGA. Deletion right flank: ACCAGAAAACTCTATTCCAATATAGCAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

331 bp deletion. T608 Stop. Flanking sequences: aaaatgagaaaaggaacaactgaattggac taatttttaaacacaaaacttactattgtt. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C44H9.4. Superficially wild type. External left primer: GAACAGAATGCGTTCAGCAA. External right primer: AAATCAAAAGACCGGTTTCG. Internal left primer: CTCCAAAACCCCGTCAAGTA. Internal right primer: TTCGGTGTCCTCTTTGGTTT. Internal WT amplicon: 3088 bp. Deletion size: 737 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y41D4B.9. External left primer: AACGAGGTCTCGACTGTGCT. External right primer: CTTTTCCTTTTCTACCCCCG. Internal left primer: ATTCGGAAAGAATTTGCACG. Internal right primer: TTTCAGTCTGGGATGGGTTT. Internal WT amplicon: 2011 bp. Deletion size: 1537 bp. Deletion left flank: AGAATATTGTTTGTCTGTCCGTTTTTTTTT. Deletion right flank: AGCTGCTCTAAAATCTCCTTGCAGAAAATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T09A12.3. Superficially wild type. External left primer: TAGCATTTGTAAAACCCGGC. External right primer: AAAAACCCCCAATTTTCCTG. Internal left primer: CGAAAGCTTCAATGGGTGAT. Internal right primer: GGCTCCGAAAGCTTACCTCT. Internal WT amplicon: 2957 bp. Deletion size: 1512 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C09E7.3. Superficially wild type. External left primer: ATTCAAATTCGCGCGTAAAC. External right primer: TCAGAGCTCGCAGAACAAGA. Internal left primer: GATCCGAAACATGGTCGTTT. Internal right primer: CTTGTGCTTCCGGATTTAGG. Internal WT amplicon: 2237 bp. Deletion size: 1395 bp. Deletion left flank: TCTAGGCTTTCGATTTTTATTTCAGAAGTG. Deletion right flank: GTTTTTTTGTCCCCATATCAGTTCTGTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C18D11. Superficially wild type. External left primer: GTCGTCAGCTGATTCGTCAA. External right primer: GCGTGTTAGAAACGTGCAAA. Internal left primer: ACCGTATCCCCGGTTTTTAG. Internal right primer: TGCGATCTGCTATTGCTACG. Internal WT amplicon: 2922 bp. Deletion size: 773 bp. Deletion left flank: TACGGGTTGATCTACAAAAAACGCGGGAAT. Deletion right flank: GGTTTTTCAACTTTCTTCAAAAAAAATTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y66D12A.12. External left primer: TGGCAATCTGTTTGCTCTTG. External right primer: TAGTGGAGAGGCGCTGAAAT. Internal left primer: TCTCACACAGTGAAGCACCC. Internal right primer: AGTTGAGAACTCTGCCGCAT. Internal WT amplicon: 1862 bp. Deletion size: 1352 bp. Deletion left flank: TGCCGGGGATTAGCAGGGTGGTCCAGACGA. Deletion right flank: CTCGTGTGCCAAAAGTCCTATGAGCATTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F22D6.2. Superficially wild type. External left primer: ACTCTCCTCCCCGTCATCTT. External right primer: CCACATGAGTGGGTGTCTTG. Internal left primer: ATCAACTGATCGCCAGGAAC. Internal right primer: CTTGTGACCTGCCTCTCCTC. Internal WT amplicon: 2103 bp. Deletion size: 1041 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F46A9.5. Superficially wild type. External left primer: AATCCGTAAGGAAAACGCCT. External right primer: AGTGTTTTCGGAAATGGCAC. Internal left primer: CACTGCCAGCTGACACAACT. Internal right primer: CGCAGAATTTGAACACGTTG. Internal WT amplicon: 2194 bp. Deletion size: 1740 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T14B1.1. Superficially wild type. External left primer: TTTGGGGACATACAAGAGGG. External right primer: TCTCGCAAATAAGGCCATTC. Internal left primer: AGGAGAGGGGAGAAATGGTG. Internal right primer: TGTAATCTTTACCCGCCCAC. Internal WT amplicon: 2121 bp. Deletion size: 1117 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M03F4.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08D12.2. Superficially wild type. External left primer: TCACATGGGTTTCCATAGCA. External right primer: GACAACGCGTGGGATAGTTT. Internal left primer: AGCCTCGAACAATGAGCTGT. Internal right primer: CGATACCTACAAGGAGCCCA. Internal WT amplicon: 1734 bp. Deletion size: 942 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C41D11.8. Superficially wild type. External left primer: TCGTGTTTTTGTTTCCTCCC. External right primer: TTGTTCTGATCGCAGTTGGA. Internal left primer: CCTTTTCCACCTTCCCCTAT. Internal right primer: AAGCTTCGGGTGATTTCTGA. Internal WT amplicon: 2220 bp. Deletion size: 676 bp. Deletion left flank: CCTTCCCCTATTTCGGATGAATTTTTGTTG. Deletion right flank: AGTTACGTGTTTTTGCGAAAAACTTCGTCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M03A1.1. Superficially wild type. External left primer: CACGACGATAAGCGGTTTTT. External right primer: TAAGGCTCGGGTACCGTATG. Internal left primer: GTGTACCTCACCCCCTCTCA. Internal right primer: TCTGATTACGCAGTCATCGC. Internal WT amplicon: 3217 bp. Deletion size: 1016 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K03D3.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0212.5. Superficially wild type. External left primer: GTGATACTGCACGATGTGGG. External right primer: ATACATCCGTCCGACAGAGC. Internal left primer: GAAGTTCGATGGACGGGATA. Internal right primer: CGTCCAAATTTCAGATCCGT. Internal WT amplicon: 3260 bp. Deletion size: 1478 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T17A3.1. Superficially wild type. External left primer: ACCAATAATTTCATTGCGCC. External right primer: GCTCACCGATTTTTCTTCCA. Internal left primer: ATAAGCAGCCGACACTTGCT. Internal right primer: GTGGAGATCTTCCAACCCAA. Internal WT amplicon: 3191 bp. Deletion size: 1291 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y62H9A.9. Superficially wild type. External left primer: CCTGAACTCCAAGGACCAAA. External right primer: CTCCAATTTCCGTTCTTCCA. Internal left primer: TTCCTAAATTGTCCCCCTCC. Internal right primer: TCAAAAATCCATCCCATCGT. Internal WT amplicon: 3238 bp. Deletion size: 1380 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25H5.3. Superficially wild type. External left primer: TGAAGAGTCTATTTCGGGCG. External right primer: AAAAATAACGCTGGTCACGG. Internal left primer: AAATGCAAGTGGGTACTCGG. Internal right primer: CTGGAACGAATCGTCACTCA. Internal WT amplicon: 3001 bp. Deletion size: 1458 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y55F3AR.2. Superficially wild type. External left primer: TTGAAATTCGGAAAATTCGC. External right primer: GCTTTCAAGCTGAAAAACGG. Internal left primer: GGGTACGGTGGATTTTGATG. Internal right primer: ATAATGTCGCCACCCTCAAG. Internal WT amplicon: 2177 bp. Deletion size: 1044 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K10G6.4. Superficially wild type. External left primer: CGTGGTGGAACTTTTCAGGT. External right primer: CAATTTTCACACATTCCCCC. Internal left primer: CGCAGAGCTTCTCAAACTCC. Internal right primer: AAATGTGGAACCCTGTTTGG. Internal WT amplicon: 1811 bp. Deletion size: 1561 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C03G6.10. External left primer: GGAGCATTGATTTTTGGCAT. External right primer: AGACAAATTTGGAACGGCTG. Internal left primer: AGATGGCGAATGGATGTGTT. Internal right primer: TCACCTGGATTACAGCAGCA. Internal WT amplicon: 1912 bp. Deletion size: 1299 bp. Deletion left flank: TAACTCATTGAATATGTAATTATCAACTTT. Deletion right flank: AATATAGGCAAATAGTAGGGACCAAAGGAC. Insertion Sequence: ATAGGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E01H11.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K10G6.1. Variable vulval phenotypes. Mostly wild type and able to lay eggs, but some animals have defective vulvae and become bags of worms. Some animals have multiple pseudovulvae. External left primer: TAGACACCCCACCATTCCAT. External right primer: TCGGCTGAACCAAATACACA. Internal left primer: CAGTTCTCGGGTGGTCTGAT. Internal right primer: AGCCTAATCCTAAGCCGGAG. Internal WT amplicon: 2297 bp. Deletion size: 1922 bp. Deletion left flank: TAGTGATGTGAATGTAAAACAAAGACTTAT. Deletion right flank: GCTTAAATTTAGGTTTAGGCTTAGGCTTAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y40H7A.10. Superficially wild type. External left primer: CAACGGCAGTTCCATTTTCT. External right primer: TGAAAATTTCGGACAGGAGG. Internal left primer: TGAAGCGAACAACAAATTGC. Internal right primer: GGGCGCTATAGAAGTTGCAC. Internal WT amplicon: 2703 bp. Deletion size: 810 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0361.2. Superficially wild type. External left primer: TGACCGTTTTCCAAAACACA. External right primer: CAAAATCGGGCGTACTCATT. Internal left primer: ATTTCGACGGTTTACTTGCG. Internal right primer: CAGCCATACTTCCCAATCGT. Internal WT amplicon: 2278 bp. Deletion size: 807 bp. Deletion left flank: GCGAATAGAGAGTTAAAACTTGTGTAATGT. Deletion right flank: CTCTGTATTACTCTTTTATTGTTTTTATAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C11G6.4. External left primer: TAGCCTGCATTGGTGTTTCA. External right primer: GGCATACCCGTTTCTTCGTA. Internal left primer: TTTGACCGGTAGACTGCTGA. Internal right primer: TTGAACGGCTGAAAGTTGTG. Internal WT amplicon: 1920 bp. Deletion size: 1543 bp. Deletion left flank: AAACTTACCGTTGGCCACAGATTATTGCAT. Deletion right flank: AATTTCAAAAGTGAAAAGAGTGTGGAAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C25E10.8. Superficially wild type. External left primer: GGAAGACAAAACGGGTCTCA. External right primer: AAAAGCAAAACATCGGTTGG. Internal left primer: TAACGGGCTTAAACAGACGC. Internal right primer: GGTTTCGTTCGTCATGGACT. Internal WT amplicon: 2279 bp. Deletion size: 1885 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14C11.3. Superficially wild type. External left primer: GAATTTCGAGGAGAGCATCG. External right primer: TTTCTTGATTGGGAAATGCC. Internal left primer: ACGTGGAGTCAGAATGTCCC. Internal right primer: GGGGACGCAGAAAAATATCA. Internal WT amplicon: 3017 bp. Deletion size: 1894 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T08G5.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39A1A.5. Superficially wild type. External left primer: TGTGATGGACCAAGTGGAAA. External right primer: AACGGTGGGGGAGATAAAAA. Internal left primer: TTTTGAGGCGCTTAAGGAGA. Internal right primer: TTGAGAAAAAGCCTTTCGGA. Internal WT amplicon: 3134 bp. Deletion size: 1739 bp. Deletion left flank: GGAAAAATTGGAAATTAAATTGGAAAAAAA. Deletion right flank: TATCACTGTCCCGTCAATCATCTGAATCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T13F3.3. Superficially wild type. External left primer: GTGCTCGGGAAATATTGGAA. External right primer: AATGCCCTTTCAAGGTTGTG. Internal left primer: TTTCAGGACATTTCCCGTTC. Internal right primer: GTCGAAATCTAGATCGGCCA. Internal WT amplicon: 2368 bp. Deletion size: 846 bp. Deletion left flank: TAAGTTTATAATTATGTTTAAAACTTGCCG. Deletion right flank: GAAAATTACGCTTTTCGGATTGAGAAAATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y43F8C.5. Superficially wild type. External left primer: ATGCTCGGAAATCGAAAGAA. External right primer: ACATGGTTTTCTGTAGGGCG. Internal left primer: GGCAGAAGGTTGCTCATGTT. Internal right primer: GAATTCCGGCTCTTTTGTCA. Internal WT amplicon: 2345 bp. Deletion size: 1316 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45C12.2. Superficially wild type. External left primer: AAACGCTAGAGAGGCACCAA. External right primer: GATTTCGGAATGGTTCGAGA. Internal left primer: AGAGCACGAAGAAACGGAAA. Internal right primer: TCGTGAATCGTCTGAAGCTG. Internal WT amplicon: 2443 bp. Deletion size: 694 bp. Deletion left flank: CTTCAGCTGAAAACCAACTGGTTTATTTGT. Deletion right flank: AAATAACAATTGAAAAATACCCATAGCGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H05G16.1. External left primer: GGTCATTCTTTGGCACCAGT. External right primer: CCAAGCCGATAACCTCACAT. Internal left primer: TGAACTGAACATCTGCCAGC. Internal right primer: CTCCGCATTCCGACTGTAAT. Internal WT amplicon: 1953 bp. Deletion size: 1390 bp. Deletion left flank: GGTGTGCATCAAAGTTCGTATGCTTGATGA. Deletion right flank: GCAAAGAGATATGAACAGCTCGTTACAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K09C4.5. External left primer: ACAGGAACTTGTCTCCCCCT. External right primer: CTTCCCAAGTGGTCGATGAT. Internal left primer: TATTGAAAGCTTCACCGGCT. Internal right primer: CAACAAATCTGGTTGGGAGG. Internal WT amplicon: 2109 bp. Deletion size: 378 bp. Deletion left flank: TCAGGTTTCGCCTCCACCGCGTTAATTTTC. Deletion right flank: CAGAGTCGCCAAAATGGCTAGTCAGACAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R02D1.1. External left primer: TTTCCAACTTTTTGTTCGGG. External right primer: TTACAGGTTTCAATTCCCGC. Internal left primer: GCCACGTGGAATCAAATTCT. Internal right primer: CCCTCATCAAGGTGTAAGCC. Internal WT amplicon: 1462 bp. Deletion size: 467 bp. Deletion left flank: AACATTCCATACAGATTGAATTAGTGTTAT. Deletion right flank: AGAAAGAACTTGAGCAGGCGTTTTTCAGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27B7.5. Superficially wild type. External left primer: CTTCCAAAGATTGGCGAGAC. External right primer: GCAAAGTTGAGCGAACATGA. Internal left primer: AAATGGAGCTTGGTCGAGTG. Internal right primer: TCGGAGTGAGCATGAATCTG. Internal WT amplicon: 2251 bp. Deletion size: 1979 bp. Deletion left flank: AATTCATCGCCAAAAAATTTAAAAAAATCG. Deletion right flank: ATTCACTCAATTTTGATAAATTTACCAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27B7.6, T27B7.7. External left primer: CTCCCAACAACTGCCACTTT. External right primer: CATCAACCACTTTGTCACCG. Internal left primer: GCGATGGACCTGAGAGAGAA. Internal right primer: GCTTAAAGCCTTGCGTCAAC. Internal WT amplicon: 2002 bp. Deletion size: 1353 bp. Deletion left flank: CTTGGCTGTTGGTCAAATTTGAGGAGTACT. Deletion right flank: ACTTAAAAAATTACTATAAAAATGAGGGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45C12.3. Superficially wild type. External left primer: GCTCATTGTGCACCTCCTTT. External right primer: CTGCAACAACGACTGTCCAT. Internal left primer: AGAGTGTGGAGAGCTCGGAA. Internal right primer: CCTACACCCACAGGCTGTTT. Internal WT amplicon: 1871 bp. Deletion size: 722 bp. Deletion left flank: GAGCCATATGCCGTCCGTAAAAGCGAAGAG. Deletion right flank: ACCCAGTGAGCTTGAGCTTGAAAAACTCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K06B4.1. External left primer: CGAGTTGACAATCGCAAAGA. External right primer: CAAGCTTGGAGTTGAAAGCC. Internal left primer: AGCGAAACGTGTCATCAGTG. Internal right primer: CAAGCCTTTGACTTCTTGCC. Internal WT amplicon: 1850 bp. Deletion size: 446 bp. Deletion left flank: ATTCTTCCAAAGTGCAAAGCGTGTCGTTAT. Deletion right flank: TGCGAACAGGAGTTTTCCACGGAAGTATGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R12E2.10. Superficially wild type. External left primer: TGGACAGCTCGTTGTACTGG. External right primer: GAAAGGTCAGAACTCCAGCG. Internal left primer: AAGCCGCTCTAGAAACTCCC. Internal right primer: TTGTCGAGGAGACGGAGACT. Internal WT amplicon: 2457 bp. Deletion size: 1171 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807