More Fields
Strain Species Genotype
AGK573 C. elegans otIs225 II; daf-18(ok480) IV; armEx218. Show Description
otIs225 [cat-4::GFP] II. armEx218 [unc-119p::daf-18 + unc-119p::tagRFP + rol-6(su1006)]. Pick Rollers to maintain. Transgenic array expresses DAF-18 from unc-119 pan-neuronal promoter; rescues the HSN under-migration phenotype in daf-18 null mutants. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.
VC1294 C. elegans nhr-51(gk573) V. Show Description
K06B4.1. External left primer: CGAGTTGACAATCGCAAAGA. External right primer: CAAGCTTGGAGTTGAAAGCC. Internal left primer: AGCGAAACGTGTCATCAGTG. Internal right primer: CAAGCCTTTGACTTCTTGCC. Internal WT amplicon: 1850 bp. Deletion size: 446 bp. Deletion left flank: ATTCTTCCAAAGTGCAAAGCGTGTCGTTAT. Deletion right flank: TGCGAACAGGAGTTTTCCACGGAAGTATGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG5029 C. elegans F30A10.9(gk5733[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5733 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4664 and CGC92. gk5733 is a 957 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGAACCAAACAATCATCAGCATATGTTCCT; Right flanking sequence: AATATCAGAAAAAATTTTTGCGAAAAAGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4661 C. elegans R12E2.11(gk5730[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 792 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TATTGGAATATTATGAAAATGAGAAAACAA. Right flanking sequence: TGGCGGTAGCGGTGGCGGCGGTCATTCTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4662 C. elegans F49E8.7(gk5731[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1804 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ACAATAACCTGATTTTCTGAATCGAAAAAA. Right flanking sequence: TGGTAATGGTGTTTTTTAAAATAACTTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4663 C. elegans mdt-28(gk5732[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1149 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAAAATAAATTAAGTGGTAAAATGTTTCCC. Right flanking sequence: GAACATTTTCAATCTAAAAAAAATGATTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4664 C. elegans F30A10.9(gk5733[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
[NOTE: Please see RG5029 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 957 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGAACCAAACAATCATCAGCATATGTTCCT. Right flanking sequence: AATATCAGAAAAAATTTTTGCGAAAAAGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4665 C. elegans rps-16(gk5734[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 484 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTCAATAACAATTTTATTGTGCAACAAAAA. Right flanking sequence: ACCCTGTAATAATATATTAAACAAAGAACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4668 C. elegans col-84(gk5737[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1018 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGAACCAAGTATGCAAGTGCATACAGCCAC. Right flanking sequence: CGGTGGAACCGGAGGACGCGGAGGATCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4669 C. elegans eif-1.A(gk5738[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 760 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTTCAGCAATGCCGAAGAATAAGGGAAAG. Right flanking sequence: GTTTCTGTTCTTTCTCCCCCTAAAAATCCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4670 C. elegans M57.2(gk5739[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 4365 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGTCGTTGACTCAAGCGATTTTAGAGAAAA. Right flanking sequence: AAAAAACGGCAATTTGCCAAAAAAAAAATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.