| RW10943 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10881. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10881 [R144.3::H1-wCherry + unc-119(+)].
|
|
| RW10945 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10873. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10873 [isw-1::H1-wCherry + unc-119(+)].
|
|
| RW10963 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10879. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10879 [W10D9.4::H1-wCherry + unc-119(+)].
|
|
| RW10964 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10563. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10563 [glp-1::H1-wCherry + unc-119(+)].
|
|
| RW10993 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; wgIs94. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs94 [pal-1::TY1::eGFP::3xFLAG(P000006_G02)]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW10996 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10819. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10819 [T28H10.3::H1-wCherry + unc-119(+)].
|
|
| RW11077 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10978. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10978 [C05D10.1b::H1-wCherry + unc-119(+)].
|
|
| RW11078 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10921. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10921 [cep-1b::H1-wCherry + unc-119(+)].
|
|
| RW11082 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10917. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10917 [tps-2::H1-wCherry + unc-119(+)].
|
|
| RW11083 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10939. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10939 [F09G2.9::H1-wCherry + unc-119(+)].
|
|
| RW11084 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10932. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10932 [nhr-49.c::H1-wCherry + unc-119(+)].
|
|
| RW11085 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10934. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10934 [hmg-11::H1-wCherry + unc-119(+)].
|
|
| RW11086 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10935. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10935 [F58D2.1::H1-wCherry + unc-119(+)].
|
|
| RW11087 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10827. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10827 [dpl-1::H1-wCherry + unc-119(+)].
|
|
| RW11121 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10925. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10925 [dpy-31::H1-wCherry + unc-119(+)].
|
|
| RW11136 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10970. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10970 [pgp-2::H1-wCherry + unc-119(+)].
|
|
| RW11140 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10926. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10926 [mel-28::H1-wCherry + unc-119(+)].
|
|
| RW11141 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10915. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10915 [F17C11.1::H1-wCherry + unc-119(+)].
|
|
| RW11144 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; wgIs76. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs76 [unc-130::TY1::eGFP::3xFLAG(P000007_E01)]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW20022 |
C. briggsae |
Cbr-unc-119(stIs20000) III; stIs20022. Show Description
stIs20022 [Cbr-his-72::GFP::pie-1 3'UTR + Cbr-unc-119(+)]. C. briggsae with fluorescently labeled (GFP) histones. Reference: Zhou Z, et al. Genetics. 2010 Mar; 184(3): 853863. doi: 10.1534/genetics.109.110270 PMID: 20008572.
|
|
| RW20025 |
C. briggsae |
Cbr-unc-119(stIs20000) III; stIs20025. Show Description
stIs20025 [Cbr-his-72::mCherry::pie-1 3'UTR + Cbr-unc-119(+)]. C. briggsae with fluorescently labeled (mCherry) histones. Reference: Zhou Z, et al. Genetics. 2010 Mar; 184(3): 853863. doi: 10.1534/genetics.109.110270 PMID: 20008572.
|
|
| SD1347 |
C. elegans |
ccIs4251 I; stIs10079. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10079 [unc-54p::his-24::mCherry::let-858 3' UTR + unc-119(+)]. Published in Liu, X., et al., Cell, 2009. 139(6).
|
|
| SD1505 |
C. elegans |
ccIs4251 I; oxIs305 II. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. oxIs305 [dpy-30p::mCherry::HIS-24::unc-54 3'utr + Cbr-unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
|
|
| SHG1941 |
C. elegans |
ustSi268 I. Show Description
ustSi268 [mex-5p::tagrfp::elli-1::tbb-2 3'UTR] I. Inserted into LG I (-5.51 cM) locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544.
|
|
| SHG357 |
C. elegans |
ustSi32 II. Show Description
ustSi32 [tofu-6p::tofu-6::GFP::3xFlag::tofu-6 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475.
|
|
| SHG487 |
C. elegans |
ustSi25 II. Show Description
ustSi25 [wago-4p::3xFlag::GFP::wago-4::wago-4 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Xu F, et al. Cell rep. 2018 May 22;23(8):2482-2494. doi: 10.1016/j.celrep.2018.04.072. PMID: 29791857.
|
|
| SHG520 |
C. elegans |
ustSi56 II. Show Description
ustSi56 [tofu-6p::tofu-6::mCherry::tofu-6 3'UTR + Cbr-unc-119(+)] II. Inserted into oxTi444 of parental strain EG8080. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475.
|
|
| SHG542 |
C. elegans |
ustSi60 II. Show Description
ustSi60 [pics-1p::pics-1::GFP::3xFlag::pics-1 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475.
|
|
| SHG578 |
C. elegans |
ustSi64 II. Show Description
ustSi64 [wago-3p::3xFlag::GFP::wago-3::wago-3 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.
|
|
| SHG659 |
C. elegans |
ustSi106 II. Show Description
ustSi106 [wago-1p::3xFlag::GFP::wago-1::wago-1 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544.
|
|
| SHG670 |
C. elegans |
ustSi55 II. Show Description
ustSi55 [pid-1p::pid-1::GFP::3xFlag::pid-1 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475.
|
|
| SJZ106 |
C elegans |
foxSi27 I. Show Description
foxSi27 [pie-1p::tomm-20(gDNA)::mKate2::HA::tbb-2 3'UTR ] I. Single-copy MosSCI insertion into oxti185. Germline-specific expression of TOMM-20::mKate2::HA can be used for fluorescent identification of germline mitochondrial morphology and tissue-specific isolation of mitochondria. Reference: Ahier A, et al. Nature Cell Biol. 2018 Mar;20(3):352-360. doi: 10.1038/s41556-017-0023-x. PMID: 29358705.
|
|
| SJZ204 |
C. elegans |
foxSi37 I. Show Description
foxSi37 [ges-1p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Gut-specific expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.
|
|
| SJZ206 |
C. elegans |
foxSi39 I. Show Description
foxSi39 [gcy-6p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. ASE-specific expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.
|
|
| SJZ213 |
C. elegans |
foxSi41 I. Show Description
foxSi41 [dpy-7p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Hypodermal expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.
|
|
| SJZ216 |
C. elegans |
foxSi44 I. Show Description
foxSi44 [rgef-1p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Neuronal expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.
|
|
| SJZ328 |
C. elegans |
foxSi75 I. Show Description
foxSi75 [eft-3p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Ubiquitous expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.
|
|
| SJZ47 |
C. elegans |
foxSi16 I. Show Description
foxSi16 [myo-3p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Muscular expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.
|
|
| SS712 |
C. elegans |
ife-1(bn127) III. Show Description
Temperature sensitive sterility. Should be cultured at 15C or 20C. At 25C, spermatocytes fail in cytokinesis and accumulate as multinucleate cells unable to mature to spermatids. Milder defect in oogenesis is not temperature sensitive. Oocyte production is slowed, but appear relatively normal and are fertile. Inefficient translation of several maternal mRNAs (mex-1, oma-1, pos-1, and pal-1). Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 1, germ cell specific, P granule associated; F53A2.6). Homozygous 590 bp deletion starts at nt 191 in exon 1 and extends through exon 2 and into the 3' UTR to nt 780. The deletion removes over 70% of the coding region for IFE-1, including the helices and sheets that make up the mRNA platform and a Trp residue essential for m7GTP cap binding, suggesting it is a null mutation. Deletion breakpoint determined by sequencing by SS is: aagtggcctcaacgcgttgt//tgatgaaaattaattgtatt. The ife-1 gene is the third in an operon, but the deletion is contained completely within the ife-1 gene.
|
|
| SSM471 |
C. elegans |
iowSi8 II; unc-119(ed3) III. Show Description
iowSi8 [pie-1p::GFP1-10::him-3 3UTR + Cbr-unc119(+)] II. Germline-specific split-GFP construct. If germline silencing occurs, transgene expression can be recovered by growing worms at 25C for 2 generations. iowSi8 was generated by MosSCI insertion into Chr II ttTi5605 in parental strain EG6699. Reference: Hefel A & Smolikove S. G3. 2019 Jun 5;9(6):1933-1943. PMID: 30992318.
|
|
| SSM472 |
C. elegans |
akir-1(iow88[GFP11::akir-1]) I; iowSi8 II; unc-119(ed3) III. Show Description
akir-1(iow88[GFP11::akir-1]) I. iowSi8[pie-1p::GFP1-10::him-3 3UTR + Cbr-unc119(+)] II. CRISPR/Cas9 insertion of GFP11 tag into endogenous akir-1 locus in background strain SSM471. GFP::AKIR-1 fluorescence only observed in the germline. If germline silencing occurs, transgene expression can be recovered by growing worms at 25C for 2 generations. Reference: Hefel A & Smolikove S. G3. 2019 Jun 5;9(6):1933-1943. PMID: 30992318.
|
|
| SSM473 |
C. elegans |
rpa-1(iow89[GFP11::rpa-1]) II; iowSi8 II; unc-119(ed3) III. Show Description
rpa-1(iow89[GFP11::rpa-1]) II. iowSi8 [pie-1p::GFP1-10::him-3 3UTR + Cbr-unc119(+)] II. CRISPR/Cas9 insertion of GFP11 tag into endogenous rpa-1 locus in background strain SSM471. GFP::RPA-1 fluorescence only observed in the germline. If germline silencing occurs, transgene expression can be recovered by growing worms at 25C for 2 generations. Reference: Hefel A & Smolikove S. G3. 2019 Jun 5;9(6):1933-1943. PMID: 30992318.
|
|
| SSM474 |
C. elegans |
syp-4(iow90[GFP11::syp-4]) I; iowSi8 II; unc-119(ed3) III. Show Description
syp-4(iow90[GFP11::syp-4]) I. iowSi8[pie-1p::GFP1-10::him-3 3UTR + Cbr-unc119(+)] II. CRISPR/Cas9 insertion of GFP11 tag into endogenous syp-4 locus in background strain SSM471. GFP::SYP-4 fluorescence only observed in the germline. If germline silencing occurs, transgene expression can be recovered by growing worms at 25C for 2 generations. Reference: Hefel A & Smolikove S. G3. 2019 Jun 5;9(6):1933-1943. PMID: 30992318.
|
|
| SUR10 |
C. elegans |
rubSi6 II; rubSi7 IV. Show Description
rubSi6 [eft-3p::scFv(glo)::GFP(smu-1 introns)::tbb-2 3UTR] II. rubSi7 [eft-3p::24xGCN4::T2A::tagBFP::H2B::tbb-2 3UTR]) IV. SunTag system allows visualization of translation throughout development in real-time. This strain expresses a SunTag reporter mRNA (24xGCN4::T2A::tagBFP::H2B::tbb-2 3UTR ) and a SunTag antibody (scFv::GFP). In the absence of translation, GFP signal can be observed in the cytoplasm, nuclei and at epithelial apical membranes. At translation sites of the SunTag reporter, clustering of the GFP signal can be observed. Mature GCN4 proteins can be observed as dimmer GFP clusters. rubSi6 was inserted into ttTi5605 and also includes a partial duplication of the transgene (a portion of GFP with smu-1 introns and tbb-2 3UTR) downstream of the tbb-2 3UTR in the intact transgene. rubSi7 was inserted into cxTi10816. Reference: van der Salm E, et al. Development. 2025 May 15;152(10):dev204435. doi: 10.1242/dev.204435. PMID: 40260543.
|
|
| SUR54 |
C. elegans |
wrdSi23 I; rubSi6 II; rubSi8[*rubSi7] IV; ltIs44 V. Show Description
wrdSi23 [eft-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). rubSi6 [eft-3p::scFv(glo)::GFP(smu-1 introns)::tbb-2 3UTR] II. rubSi8 [eft-3p::24xGCN4::AID::T2A::tagBFP::H2B::tbb-2 3UTR *rubSi7]) IV. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)] V. SunTag system allows visualization of translation throughout development in real-time. In the absence of translation, GFP signal can be observed in the cytoplasm, nuclei and at epithelial apical membranes. At translation sites of the SunTag reporter, bright clustering of the GFP signal can be observed. Mature GCN4 proteins can be observed as dimmer GFP clusters in the absence of auxin, but not in the presence of auxin. Bright BFP signal from mTagBFP2::AID*::NLS and TagBFP::H2B can be visible in nuclei in the absence of auxin, in the presence of auxin only dimmer TagBFP::H2B is visible in nuclei. mCherry::PH marks the cell membranes throughout development. rubSi6 was inserted into ttTi5605 and also includes a partial duplication of the transgene (a portion of GFP with smu-1 introns and tbb-2 3UTR) downstream of the tbb-2 3UTR in the intact transgene. rubSi8 derived by modification of insertion of an AID tag into rubSi7, which is located in cxTi10816. Reference: van der Salm E, et al. Development. 2025 May 15;152(10):dev204435. doi: 10.1242/dev.204435. PMID: 40260543.
|
|
| SUR72 |
C. elegans |
rubSi6 II. Show Description
This strain expresses a SunTag antibody (scFv::GFP) throughout development. GFP signal can be observed in the cytoplasm, nuclei and at epithelial apical membranes. rubSi6 [eft-3p::scfv(glo)::gfp(smu-1 introns)::tbb-2 3UTR] was inserted into ttTi5605, and also includes a partial duplication of the transgene (a portion of GFP with smu-1 introns and tbb-2 3UTR) downstream of the tbb-2 3UTR in the intact transgene. Reference: van der Salm E, et al. Development. 2025 May 15;152(10):dev204435. doi: 10.1242/dev.204435. PMID: 40260543.
|
|
| SV1361 |
C. elegans |
unc-119(ed3) III; heIs105 IV. Show Description
heIs105 [rps-27::loxP::NLS::mCherry::let858 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. Strain is viable at 15-25 C. heIs105 carries a read-out construct which allows the visualization of the CRE lox mediated recombination by a switch from red to green. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
|
|
| SV1440 |
C. elegans |
unc-119(ed3) III; heIs105 IV; heSi141 X. Show Description
heIs105 [rps-27::loxP::NLS::mCherry::let858 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. heSi141 [hlh-8(short)::FLAG::CRE::tbb-2 + unc-119(+)] X. Maintain at 15-25C. Expression of CRE recombinase in the mesoblast lineage driven by the hlh-8 promoter. heIs105 carries a read-out construct which allows the visualization of the CRE lox mediated recombination in the mesoblast lineage by a switch from red to green. This read-out construct is silenced in the germline. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
|
|
| SV1448 |
C. elegans |
fzr-1(ku298) II; unc-119(ed3) III; heSi143 IV; heSi141 X. Show Description
heSi 143 [rps-27::loxP::mCherry::let-858::fzr-1p::fzr-1::fzr-1 UTR::loxP::GFP::let-858 UTR + unc-119(+)] IV. heSi141 [hlh-8(short)::FLAG::CRE::tbb-2 + unc-119(+)] X. Maintain at 15-25C. Expression of CRE recombinase in the mesoblast lineage driven by the hlh-8 promoter. heSi143 rescues fzr-1(ku298). fzr-1 will be excised upon mesoblast-specific expression of CRE, creating a mesoblast specific mutant of fzr-1. This recombination event can be visualized by a switch from red to green in those cells (the mesoblast) were fzr-1 is lost. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
|
|
| SV1450 |
C. elegans |
unc-119(ed3) III; heIs145 IV Show Description
heIs145 [rps-27::loxP::NLS::mCherry::let858 UTR::eft-3::tagBFP::tbb-2 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. Maintain at 15-25C. heIs145 expresses a read-out construct used to visualize CRE activity and specificity, and to test whether CRE expression is likely to induce loss of a gene of interest (tagBFP in this case) in a given tissue. Expression of CRE will result in a change from mCherry to GFP and loss of tagBFP expression in those cells where CRE is active. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
|
|