| BC4860 |
C. elegans |
dpy-17(e164) let-743(s2830) ncl-1(e1865) unc-32(e189) III; sDp3 (III;f). Show Description
Maintain by picking Uncs.
|
|
| BC4862 |
C. elegans |
let-736(s2832) dpy-17(e164) ncl-1(e1865) unc-32(e189) III; sDp3 (III;f). Show Description
Maintain by picking Uncs.
|
|
| BC4863 |
C. elegans |
dpy-17(e164) cyk-1(s2833) ncl-1(e1865) unc-32(e189) III; sDp3 (III;f). Show Description
Maintain by picking Uncs. cyk-1 was previously known as let-794 (in Stewart et al 1998).
|
|
| BC4867 |
C. elegans |
let-734(s2837) dpy-17(e164) ncl-1(e1865) unc-32(e189) III; sDp3 (III;f). Show Description
Maintain by picking Uncs. pka let-833(s2837).
|
|
| BC4868 |
C. elegans |
let-791(s2838) dpy-17(e164) ncl-1(e1865) unc-32(e189) III; sDp3 (III;f). Show Description
Maintain by picking Uncs.
|
|
| BC4870 |
C. elegans |
dpy-17(e164) let-775(s2840) ncl-1(e1865) unc-32(e189) III; sDp3 (III;f). Show Description
Maintain by picking Uncs.
|
|
| BC4879 |
C. elegans |
dpy-17(e164) let-795(s2849) ncl-1(e1865) unc-32(e189) III; sDp3 (III;f). Show Description
Maintain by picking Uncs.
|
|
| BC4880 |
C. elegans |
dpy-17(e164) let-798(s2850) ncl-1(e1865) unc-32(e189) III; sDp3 (III;f). Show Description
Maintain by picking Uncs. DpyUncs die as embryos.
|
|
| BC4882 |
C. elegans |
dpy-17(e164) let-799(s2852) ncl-1(e1865) unc-32(e189) III; sDp3 (III;f). Show Description
Maintain by picking Uncs.
|
|
| BC4997 |
C. elegans |
dpy-17(e164) let-755(s2861) unc-32(e189) III; sDp3 (III;f). Show Description
Maintain by picking Uncs. DpyUncs arrest at early-mid larval stages.
|
|
| FF628 |
C. elegans |
let-756(s2613) unc-32(e189) III. Show Description
Homozygous viable and fertile, but slow growing, transparent and small. Originally from BC4253 but outcrossed an additional 7 times.
|
|
| GE2364 |
C. elegans |
let-771(t1554) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|
| GE2690 |
C. elegans |
let-733(t1683) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|
| GE2935 |
C. elegans |
let-725(t1440) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs. t1440 previously called mel-27.
|
|
| GE2946 |
C. elegans |
let-748(t1452) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|
| JK6526 |
C. elegans |
let-711(q1238[let-711::3xV5]) III. Show Description
GSS linker and 3xV5 tag inserted at C-teminus of endogenous let-711 locus. Generated in N2 background. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
|
|
| OH2638 |
C. elegans |
dpy-17(e164) let-756(s2887) unc-32(e189) III; oyIs14 V; otEx1467. Show Description
oyIs14 [sra-6::GFP + lin-15(+)]. otEx1467 [let-756(+) + ceh-22p::GFP]. Animals carrying otEx1467 are DpyUnc. Animals which have lost the otEx1467 array are DpyUncLet.
|
|
| OH2639 |
C. elegans |
dpy-17(e164) let-756(s2887) unc-32(e189) III; oyIs14 V; otEx1468. Show Description
oyIs14 [sra-6::GFP + lin-15(+)]. otEx1468 [let-756(+) + ceh-22p::GFP]. Animals carrying otEx1468 are DpyUnc. Animals which have lost the otEx1468 array are DpyUncLet.
|
|
| OH2984 |
C. elegans |
otEx1765. Show Description
otEx1765 [let-765::GFP + rol-6(su1006)]. Maintain by picking Rollers.
|
|
| OH2985 |
C. elegans |
otEx1766. Show Description
otEx1766 [let-765::GFP + rol-6(su1006)]. Maintain by picking Rollers.
|
|
| OH2987 |
C. elegans |
otEx1768. Show Description
otEx1768 [let-756::GFP + dpy-7::RFP + rol-6(su1006)]. Maintain by picking Rollers.
|
|
| PJ1153 |
C. elegans |
clr-1(e1745) II; let-756(s2613) unc-32(e189) III; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Homozygous viable and fertile, but slow-growing, transparent, and small (but not scrawny). Coiler Unc. clr-1 is temperature-sensitive.
|
|
| PJ1155 |
C. elegans |
let-756(s2613) unc-32(e189) III; ccIs55 V; egl-17(n1377) X. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Egg laying defective. Moderate to severe bloating. >50% make bags of worms.
|
|
| PJ1158 |
C. elegans |
clr-1(e1745) II; let-756(s2613) unc-32(e189) III; ccIs55 V; egl-17(n1377) X. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Egl: moderate to severe bloating. Clr-1 is ts. Homozygous viable and fertile, but slow-growing, transparent, and small (but not scrawny). Coiler Unc.
|
|
| RG3438 |
C. elegans |
let-767(ve938[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III. Larval lethal. Deletion of 1104 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) early larval lethal (ve938 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: ATCCATGAGCTCGAGTTGAAGTTGATGCGT; Right flanking sequence: TGGAATTTACAGAATTTCAATGGAAATAAC. let-767 sgRNA A: GATGTATCCGGTGGTGTCTG; let-767nsgRNA B: CACTGGCAAGCCATGTTACC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RL67 |
C. elegans |
lon-1(e185) let-711(it150) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles, and Lon Uncs which are temperature sensitive maternal effect lethals. Embryos from homozygyous it150 hermaphrodites have spindle orientation defects at second and third cleave at 25C.
|
|
| VC1622 |
C. elegans |
let-765(ok2058) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F20H11.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2058 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAATCGTATTGCTGCTTCCA. External right primer: CGGAGCTGGTGTAGGAAAAG. Internal left primer: GTCCATTCGAATCTTTCCGA. Internal right primer: TGCTGAACGTGATCTTCGAG. Internal WT amplicon: 3229 bp. Deletion size: 1540 bp. Deletion left flank: CACAGATTCTAGATGAAGTGATAAAATCCG. Deletion right flank: TTTTGAAGTTCTAAGACCATTCGTCCAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VT1153 |
C. elegans |
unc-119(ed3) III; maIs137. Show Description
maIs137 [let-7p::GFP + unc-119(+)]. Wild type.
|
|
