Search Strains

Paralyzed Rigid Unc. Muscle birefrigence normal. Muscle normal in EM.

umnIs74 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] X. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.

qIs74 [sys-1p::GFP::pop-1 + unc-119(+)]. Probably on LG X. May have unc-119 in background. Throws 30% males. Do not distribute this strain; other labs should request it from the CGC.

wgIs74 [hlh-8::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

enIs74 [mec-7p::GFP + dyn-1p::mfg-e8::mCherry + unc-76(+)] II. mec-7p::GFP labels touch neurons. MFG-E8::mCherry reporter binds exposed phosphatidylserine (PS) “eat me” signal on the surface of apoptotic or necrotic cells, providing a useful marker for identifying apoptotic or necrotic cells. Reference: Furuta Y, et al. PLoS Genet. 2021 Feb 11;17(2):e1009066.

otIs742 [nlp-13p::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650

AWC neurons are marked with mCherry. AWC nuclei can be isolated by INTACT.

otIs355 [rab-3p::2xNLS::TagRFP] IV. otIs747 [srg-13p::GFP]. PHA neurons are labeled with GFP and RFP. Can be used to isolate PHA by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

otIs748 [rab-3p(prom1)::GFP + ttx-3p::mCherry] X. Pan-neuronal cytoplasmic GFP expression. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341

wgIs740 [lin-32::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

wgIs741 [npax-2::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

wgIs742 [C02F12.10::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

wgIs743 [lin-54::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

wgIs744 [hlh-13::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

wgIs745 [mxl-3::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

wgIs746 [tbp-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

wgIs748 [ceh-6::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

wgIs749 [tlf-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

nsIs746 [nep-2(prom7)::GFP]. GFP expression specifically in GLR glia. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.

sy143 suppresses sy97 viability from 15% to 100%, P12 -> P11 transformations from 27% to 14% and Vul from 100% to 3%. Do not distribute this strain; other labs should request it from the CGC.

syIs742 [Y41C4A.6p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASG neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.

syIs743 [pks-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for CAN neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.

syIs748 [tbh-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for RIC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.

Heterozygotes are WT and segregate WT, Dpys (mT1 homozygotes) and L1 lethals (bn126 homozygotes). klp-19 deletion is 435 bases between TTCACAGTGTTCGTGGAGAA and GCAAGGAATCGCGCCGGCT. klp-19 deletion is lethal over hT2.

bnIs1 [pie-1::GFP::pgl-1 + unc-119(+)]. GFP is brightest at 25C and the strain should be grown at that temperature. Routinely pick bright GFP+ worms to maintain. Because the transgene can become silenced, you should check the worms for GFP expression and freeze as soon as possible.

Maintain by picking GFP+ worms. deps-1 mutants are temperature-sensitive maternal-effect sterile (>80% sterile at 24.5C). Grow these balanced worms at 25C to verify that GFP+ worms are fertile and GFP- worms (deps-1 M+Z-) produce sterile progeny (M-Z-). It is best to keep deps-1 balanced because deps-1 M-Z- animals tend to lay many dead eggs and fewer eggs than WT at lower temps (15-20C).

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ceh-30 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

wyIs581 [ser-2(prom3)::myr::mCherry + odr-1p::GFP] IV. wyIs740 [ser-2(prom3)::dma-1::GFP + odr-1p::GFP] IV. GFP inserted into DMA-1 after transmembrane region and before cytoplasmic tail in wyIs740 reporter. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.

wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. mec-4(e1611) is a gain of function point mutation. wyIs740 [ser-2(prom3)::dma-1::GFP + odr-1p::GFP] IV. GFP inserted into DMA-1 after transmembrane region and before cytoplasmic tail in wyIs740 reporter. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.

hpIs740 [twk-40(s)p::GCaMP6s::wScarlet + lin-15(+)]. GCaMP and RFP expression in AVA, AVB, AVE and DVA. Reference: Lu Y, et al. 2022. Current Biology (In Press).