Search Strains

More Fields
Strain Species Genotype Add
VC42 C. elegans qua-1(gk32)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T05C12.10. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and gk32 homozygotes (early larval arrest). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
UT1343 C. elegans crh-2(gk3293) II; crh-1(tz2) III. Show Description
Double mutant with loss of function in both CREB genes. Derived by crossing parental strains YT17 crh-1(tz2) and VC3149 crh-2(gk3293). Reference: Merritt DM, et al. A Novel Memory Type in C. elegans Exhibits Post-Training Consolidation. bioRxiv 2023.02.22.529281. doi: https://doi.org/10.1101/2023.02.22.529281.
VC1979 C. elegans R12B2.3(gk3268) R12B2.2(gk3269) tbx-34(gk1051) III. Show Description
This strain is homozygous for a deletion (gk1051) in Y47D3A.10, detectable by PCR using the following primers. External left primer: AGTTGTGGCTTCTGCGAACT. External right primer: CACCCACTGACACCATTGAG. Internal left primer: ATGGTCAGGACGGGAATGTA. Internal right primer: TTTCTCCACTGCAACGTGAC. Internal WT amplicon: 2318 bp. Deletion size: 971 bp. Deletion left flank: TTTTTGTGCAGCAATTTTTGCGGCGGCTGA. Deletion right flank: GGTGTCAGTGAATGTAGGCAGCCATGAAGC. Validation: gk1051 passed by diagnostic PCR, CGH. Other deletions (gk3268, gk3269) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2109 C. elegans Y53F4B.4&Y53F4B.42(gk1068) II; T25B9.10(gk3262) IV; K04C1.5(gk3263) X. Show Description
This strain is homozygous for a deletion (gk1068) in Y53F4B.4 and Y53F4B.42, detectable by PCR using the following primers. External left primer: GGCAAAATTGTACGCATCCT. External right primer: CTTGTTTCGCTCGATTCACA. Internal left primer: TCTCGTTAGGTATTTGCGGC. Internal right primer: CGCAACTGCGTTAAATCGTA. Internal WT amplicon: 2605 bp. Deletion size: 557 bp. Deletion left flank: AATAGAAAATGCATTTTAAAATGCGAAAAA. Deletion right flank: CCCGATTTTTGACCGATGACACCAAAGTTT. Validation: gk1068 passed by CGH. Other deletions (gk3262, gk3263) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2133 C. elegans C11E4.7(gk3221) dhhc-1(gk1067) X. Show Description
This strain is homozygous for a deletion (gk1067) in F09B12.2, detectable by PCR using the following primers. External left primer: TGGTGGAGGTTTTCAAGGAG. External right primer: GCGTCATGGTGGGTAAAATC. Internal left primer: AAAGTGAACAGCGAAACGGT. Internal right primer: TAACTGGCAGCAGTGGTGAG. Internal WT amplicon: 1907 bp. Deletion size: 502 bp. Deletion left flank: TATAAGCCTGGCTGAAAGTTACGAATTTGG. Deletion right flank: AAAATTTGAATGAAATGTAAAGTTGAAGTA. Validation: gk1067 passed by diagnostic PCR, CGH. Other deletion (gk3221) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2144 C. elegans T24F1.2(gk3219) II; T26A8.4(gk3176) IV; ubc-17(gk3220) X. Show Description
This strain is homozygous for a deletion (gk3176) in T26A8.4, detectable by PCR using the following primers. External left primer: TGCTTTGGCTCTTCTTGGAT. External right primer: TGTTTGCGCTGAGAGAGAGA. Internal left primer: GCTGAACTAATCCAGGCTGC. Internal right primer: TCCAACGTTCAAGATTCCAA. Internal WT amplicon: 1977 bp. Deletion size: approximately 625 bp. Validation: gk3176 passed by CGH. Left deleted probe: TTGCGGTGGCTGAACTAATCCAGGCTGCTGAAGATGTGGATGTTGAATTG. Right deleted probe: AAACTAACCTTTTTACAAAAACTATTAGCATAAAAGTTGCACAGAACAGG. Other deletions (gk3219, gk3220) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2319 C. elegans ZK185.1(gk3229) IV. Show Description
ZK185.1. Homozygous viable deletion, detectable by nested PCR. External left primer: TCCAAGTCAGCGCCTCTTAT. External right primer: AATTCAGCGAAAATGATCCG. Internal left primer: TTGGCGATGAACGTACCATA. Internal right primer: AATCGTGTAGCTGGTGGAGG. Internal WT amplicon: 1766 bp. Deletion size: 472 bp. Deletion left flank: TTCACAAAAAGTTAGATAAAAAGGTTGTGC. Deletion right flank: CAGCTAGTTTTTGTGCATTTTCTCAGATGT. Insertion sequence at break: GGCTAGTTTTTGTG. Validation: gk3229 confirmed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2340 C. elegans W02D9.3(gk1128) I; rbf-1(gk3217) III; srh-145(gk3218) V. Show Description
This strain is homozygous for a deletion (gk1128) in W02D9.3, detectable by PCR using the following primers. External left primer: ACGGATTTTGCCACTTTGTC. External right primer: CATCACATTTCTCGTGGTGG. Internal left primer: TTGGAGAGGTGTGAACGTAGAA. Internal right primer: TTTCTAGGCCGTACGTTGCT. Internal WT amplicon: 1621 bp. Deletion size: 1315 bp. Note: internal left primer binding site deleted in gk1128; major deletion product from nested PCR runs at about 650 bp. Deletion left flank: GCAGAAAAAATTTTGGAATTTGAGCTACAT. Deletion right flank: CATTTTCTTGCAGAAAAACGTGCAAAATTC. Validation: gk1128 passed by CGH. Other deletions (gk3217, gk3218) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2353 C. elegans F57A8.1(gk3231) V. Show Description
F57A8.1. Homozygous viable deletion, detectable by nested PCR. External left primer: GCAAGTCGAAGAAACTTCCG. External right primer: CAAAATGTCCATCATTCCCC. Internal left primer: TCCGTGCGAAATTATGTTCA. Internal right primer: AACCTTTCCGTTTCATCACG. Internal WT amplicon: 2669 bp. Deletion size: 2229 bp. Deletion left flank: GCAAAAAGTTGTTTCAATGCAGAATAATTT. Deletion right flank: ATATCAAATAAGCGGGATTAAGCGACTTAC. Insetion sequence at break: GCAGAATACATATTCATTAGATAAATA.Validation: gk3231 confirmed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2371 C. elegans W03B1.2(gk3214) dct-15(gk3215) IV; C47E8.6(gk1082) V; F53H4.5(gk3216) X. Show Description
This strain is homozygous for a deletion (gk1082) in C47E8.6, detectable by PCR using the following primers. External left primer: CCGTTACCATGCCAACTCTT. External right primer: TGATTTTGGCCGAGTAGGAC. Internal left primer: CCGTCACCTCTTAACGGAAA. Internal right primer: CGAACCAACCAGAATCTTCG. Internal WT amplicon: 1333 bp. Deletion size: 468 bp. Deletion left flank: GACCAATGCAGCTTCCCGTCGAAAACCTGC. Deletion right flank: GAATATCTTAAGACAATCTGATGATCTTCT. Validation: gk1082 passed by diagnostic PCR, CGH. Other deletions (gk3214, gk3215, gk3216) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2424 C. elegans B0336.11(gk1130) T03F6.4(gk3213) III. Show Description
This strain is homozygous for a deletion (gk1130) in B0336.11, detectable by PCR using the following primers. External left primer: TGTTTCCTGAAGTGGCACAG. External right primer: AGCACTCACTGAAGGGGAGA. Internal left primer: ATTCTGCCTTGTTGCTTGCT. Internal right primer: CCGTTGCTCTCTGTGCTCTA. Internal WT amplicon: 2566 bp. Deletion size: 416 bp. Deletion left flank: TAATAAACTTCATTGCGTCAAAGCTCTGAA. Deletion right flank: CATAATTGCATATGCAATATCTACATCGTA. Validation: gk1130 passed by CGH. Other deletion (gk3213) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2461 C. elegans Y22D7AL.7(gk3210) III; R11E3.2(gk3211) ZK616.3(gk3212) IV; F39F10.2(gk1161) X. Show Description
This strain is homozygous for a deletion (gk1161) in F39F10.2, detectable by PCR using the following primers. External left primer: GTGCTCACCGAGATGTCTGA. External right primer: GCTGATTTCGCTCAACACAA. Internal left primer: GACCCGGTAATTGAGCAGAA. Internal right primer: TGCGAACATTCGTTGAGTTC. Internal WT amplicon: 2489 bp. Deletion size: 500 bp. Deletion left flank: TTCAATTAGGATGTCGTAAACGCAGTGGCT. Deletion right flank: GTGATATCCTAAAAATTATGTTTAAGTTAT. Validation: gk1161 passed by CGH. Other deletions (gk3210, gk3211, gk3212) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2656 C. elegans T22E7.2(gk1105) I; Y39C12A.7(gk3222) IV; gkDf33 X. Show Description
This strain is homozygous for a deletion (gk1105) in T22E7.2, detectable by PCR using the following primers. External left primer: GAAGGTGTGAAAAGACGGGA. External right primer: TGCAGGAAAAGCAACAAGAA. Internal left primer: TGGTCTGTAGAGCCCATTCA. Internal right primer: GTGTTGGAGAAACGTGGGAT. Internal WT amplicon: 2319 bp. Deletion size: 568 bp. Deletion left flank: TGATATTTTACTGATAATTATACACTTTCA. Deletion right flank: CTTCAAACATACGCTTCATCTTTTCGCGAA. Validation: No CGH probes for gk1105. Other deletions (gk3222, gkDf33) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2802 C. elegans K11D9.3(gk3223) III; srv-13(gk3224) IV; hlh-34(gk1211) V. Show Description
This strain is homozygous for a deletion (gk1211) in T01D3.2, detectable by PCR using the following primers. External left primer: GTGAAGCCGAAGGATCATGT. External right primer: CGTCTTTGCTTTCTTTTCCG. Internal left primer: GAAGAACTTTGCATCGAGGG. Internal right primer: TGTCCAACAATTTCCAACGA. Internal WT amplicon: 1737 bp. Deletion size: 301 bp. Deletion left flank: TTAAAAAACAGAAAAAAAATTAAAAATATA. Deletion right flank: CATCTCCGCGCCTGTCCAGTATCACAAAGA. Validation: gk1211 passed by CGH. Other deletions (gk3223, gk3224) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3110 C. elegans ztf-22(gk3235) II. Show Description
Y48C3A.4. External left primer: CCATTTCTAACATAGGGGCTTTATT. External right primer: TATTTCGGCATTTTACCAAATTTTA. Internal left primer: TGTGAAAAAGAGCCAAATTGATAA. Internal right primer: GAGGTTTTTCCTGAAAATTGAAAA. Internal WT amplicon: 1190 bp. Deletion size: 369 bp. Deletion left flank: TTTGGAGCAACGTGTTTAAAGTGTTGAAGA. Deletion right flank: GGTTGGCAAGTGTTAAAATGTCCAAATATC. Validation: gk3235 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3121 C. elegans T07D10.1(gk3249) I; F59E12.3(gk3183) II; Y116A8C.5(gk3250) IV; unc-83(gk3251) gkDf35 V; gkDf32 X. Show Description
This strain is homozygous for a deletion (gk3183) in F59E12.3, detectable by PCR using the following primers. External left primer: GCATGCAAGAAATGCAAGAA. External right primer: TGAAGTCGCGCACAAATAAG. Internal left primer: TCACAAATGGAAACGTGTGG. Internal right primer: CAACGAGGCCAAAGTGATTT. Internal WT amplicon: 1320 bp. Deletion size: 585 bp. Deletion left flank: GAACTGACAACAAGTATCTCAACCTACACG. Deletion right flank: CCCCCGTTTATGCGCCCAGGGCATCCCACA. Validation: gk3183 passed by CGH. Other deletions (gkDf32, gkDf35, gk3249, gk3250, gk3251) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3124 C. elegans Y74C9A.3(gk3247) I; C03C10.2(gk3027) III; gkDf34 V. Show Description
This strain is homozygous for a deletion (gk3027) in C03C10.2, detectable by PCR using the following primers. External left primer: ACTACCGTGCTCTTGGCACT. External right primer: TCAACCTCACCCCATTTCTC. Internal left primer: GCATGTGTCTACCATCCACG. Internal right primer: GCAGTGATTTCGGGCTGTAT. Internal WT amplicon: 2385 bp. Deletion size: 826 bp. Deletion left flank: ATGCATTGAAAGATATTCATGATATGGGAT. Deletion right flank: TCAAAACCGAATCCGGTGTATGCATTCCAT. Validation: gk3027 passed by CGH. Other deletions (gk3247, gkDf34) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3125 C. elegans ccch-1&F38B7.12(gk3237) V; gkDf32 X. Show Description
This strain is homozygous for a deletion (gk3237) in F38B7.1, detectable by PCR using the following primers. External left primer: TTTATCAGGCAATCCCAACC. External right primer: CGTATGCCCTCATGTTTGTG. Internal left primer: AGTTCGAACAGCTGCCAAAT. Internal right primer: GCGACAAAGCCAATTAGTCC. Internal WT amplicon: 1490 bp. Deletion size: 243 bp. Deletion left flank: TCCAAGAATTTCAATGTATACTTCTCACAT. Deletion right flank: GAAAAATTATATCCTTTTTACTTAAATAAC. Validation: No CGH probes for gk3237. Other deletion (gkDf32) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3132 C. elegans crml-1(gk3284) I; gkDf32 X. Show Description
This strain is homozygous for a deletion (gk3284) in K07G5.1, detectable by PCR using the following primers. External left primer: TTGCCTTTTGTAGATGTGATAGGA. External right primer: TAATCCGAAAGTCACAAAATCTGA. Internal left primer: GTCCCCACAGATGACGTTCT. Internal right primer: CCTTGCATCAGCTTTTCACA. Internal WT amplicon: 1884 bp. Deletion size: 608 bp. Deletion left flank: TTGAGCTCTTCGAGACACTGAAAATGAGAT. Deletion right flank: CTAGAAAAATTTAATTTTAAGTCAAGCATA. Validation: gk3284 passed by CGH. Other deletion (gkDf32) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3133 C. elegans hlh-33(gk3285) III; gkDf32 X. Show Description
This strain is homozygous for a deletion (gk3285) in Y39A3CR.6, detectable by PCR using the following primers. External left primer: TGCATTTTCCAAAAGTTTAAATCA. External right primer: ACGACATTTTGTTTACAAGGAACA. Internal left primer: TCGATCAAAAACTTGGACAGC. Internal right primer: AGTGTGCATTTGATTGTCACG. Internal WT amplicon: 1494 bp. Deletion size: 353 bp. Deletion left flank: AACCACCGCTGCTCTCCGACCCGCTCGTCC. Deletion right flank: TTAGAAAAAATGGGAAAAAAAATTCTCAAA. Validation: gk3285 passed by CGH. Other deletion (gkDf32) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3134 C. elegans Y53F4B.3(gk3286) II; gkDf49 Y51A2B.6(gk3540) V. Show Description
This strain is homozygous for a deletion (gk3286) in Y53F4B.3, detectable by PCR using the following primers. External left primer: GAAACCGGTCTCAACACGAT. External right primer: TTGGTGTCATCGGTCAAAAA. Internal left primer: TCGGCAAATTTATCTCTCGC. Internal right primer: GCACTTTCTCGTCTGCCTTT. Internal WT amplicon: 807 bp. Deletion size: 509 bp. Deletion left flank: CGATTTCGAGAACGGTCTCCGGAAGCTCTT. Deletion right flank: TCCTCCTCGCTCATTTGCGCGATCGGAGCG. Insertion Sequence: TCATCT. Validation: gk3286 passed by CGH. Other deletion (gk3540) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3135 C. elegans F11E6.1(gk3287) IV. Show Description
F11E6.1. External left primer: AAAAACGTTCTAAGGCTAAATTGCT. External right primer: AAATTCAGCACAATAGAGAATCCTG. Internal left primer: CGGTTTTAATGGCTCCAAAA. Internal right primer: CTTGAGCAGTTCGGTTGACA. Internal WT amplicon: 2099 bp. Deletion size: 464 bp. Deletion left flank: TTTTAAAAGATTTTTCGAAGCCTATTCATC. Deletion right flank: ATTCATCATGGCCCATTAATGGGTGACTGG. Validation: gk3287 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3146 C. elegans fln-1(gk3291) IV; cdf-1(gk3543) X. Show Description
This strain is homozygous for a deletion (gk2191) in Y66H1B.2, detectable by PCR using the following primers. External left primer: AGCGAGTCCAGTGTCGATTT. External right primer: ACGTGAAGCTGGAGAGCATT. Internal left primer: GACATCCTTAATCCGGACCC. Internal right primer: AGAACCAGGAGTCTACGCGA. Internal WT amplicon: 1864 bp. Deletion size: 1225 bp. Deletion left flank: ATGGATTAGATACTTCTCTTCTAACTTTAT. Deletion right flank: CATTTTTATTTCCTAGTGAATATTACCTTA. Insertion Sequence: TTTTCCCATATTTCAGATATTACTACAATACGCTCGGTA. Validation: gk3291 passed by CGH. Other deletion (gk3543) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3149 C. elegans crh-2(gk3293) II. Show Description
C27D6.4. External left primer: ATGTGATGGAGTGGGTGGTT. External right primer: GTTGTACCGCCAACGTCTTT. Internal left primer: ACACGAAAGGGGGAGAAAAT. Internal right primer: GATTGGACGGATCAGAAGGA. Internal WT amplicon: 1448 bp. Deletion size: 987 bp. Deletion left flank: AAATGGTTTACCCTAGGGAGAAAATGGTTT. Deletion right flank: TGAAATGTTTCATTATTACTTTTAGAAAAA. Insertion Sequence: GTGTTTCATTATATTTCATTATTT. Validation: gk3293 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3164 C. elegans ztf-22(gk3296) II. Show Description
Y48C3A.4. External left primer: CCATTTCTAACATAGGGGCTTTATT. External right primer: TATTTCGGCATTTTACCAAATTTTA. Internal left primer: TGTGAAAAAGAGCCAAATTGATAA. Internal right primer: GAGGTTTTTCCTGAAAATTGAAAA. Internal WT amplicon: 1190 bp. Deletion size: 407 bp. Deletion left flank: CAGAGGCGTTGTTGTTGGTGAGTGACTAAT. Deletion right flank: TTTGTAAATTCTGAAAAATTGCCACTTTTA. Validation: gk3296 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3195 C. elegans oig-1(gk3204) III; Y41D4B(gk3099) IV; pqn-11(gk3205) X. Show Description
This strain is homozygous for a deletion (gk3099) in Y41D4B, detectable by PCR using the following primers. External left primer: GAAACGTTGGAAAAACGGAA. External right primer: CTTTGTTCGCTGCGTAATGA. Internal left primer: CAATTTCCATACCCTCGCTC. Internal right primer: CGCACACAAGCCTTAACTCA. Internal WT amplicon: 1594 bp. Deletion size: 191 bp. Deletion left flank: GGAAACTGTGTGTTTCTGAAAATAGAGGTT. Deletion right flank: GACCACCCCAAGTGTCCTAACTCGGAGCCA. Insertion Sequence: AAAA. Validation: No CGH probes for gk3099. Other deletions (gk3204, gk3205) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3198 C. elegans hip-1(gk3264) III. Show Description
T12D8.8. External left primer: GCTGCAGGAATCACTGACAA. External right primer: GAGACGCGAGGAAGAACAAC. Internal left primer: TGGGTCTTCCACCAAAGAAG. Internal right primer: GCGCAAATGCACAGAATATG. Internal WT amplicon: 1339 bp. Deletion size: 689 bp. Deletion left flank: AGCCTTGTGCCGAGTCTGGGTTGATAGAGA. Deletion right flank: GAATTGAAGTGTTTATTCAATTTGTTTGGA. Validation: gk3264 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3205 C. elegans R05D7.1(gk3201) I; alh-4(gk3187) V; clh-4(gk3202) C24H10.2(gk3203) X. Show Description
This strain is homozygous for a deletion (gk3187) in T05H4.13, detectable by PCR using the following primers. External left primer: AAGGACCTTCGAAACATAAGGAG. External right primer: ATCTCCACCCTCCCAATTAAATA. Internal left primer: AAGCAGGTGCTGACTGTGTG. Internal right primer: CATTCCAAATTTCGGCAGTT. Internal WT amplicon: 2323 bp. Deletion size: 512 bp. Deletion left flank: ACCACTGCTAGTCTCATTCAAAAGGCGTTT. Deletion right flank: GATCAAAAATGGAGGAAAAATCAACAAAAA. Validation: gk3187 passed by CGH. Other deletions (gk3201, gk3202, gk3203) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3239 C. elegans F36H2.3(gk3206) dys-1(gk3207) I; Y67H2A.10(gk3163) IV; srh-56(gk3209) V. Show Description
This strain is homozygous for a deletion (gk3163) in Y67H2A.10, detectable by PCR using the following primers. External left primer: TTGAACATCGGAAACTGCAA. External right primer: GATTCTAGGCCACCGTTCAA. Internal left primer: ACCAGGGCACACGAAATAGA. Internal right primer: GCACCAATGAATCTACCGCT. Internal WT amplicon: 2510 bp. Deletion size: 1275 bp. Deletion left flank: ATTTAACCCCTTTTCATCAAAATTTTGAAT. Deletion right flank: ACATTTTTTAAATATTTATTGTATGAAGAA. Validation: gk3163 passed by CGH. Other deletions (gk3206, gk3207, gk3209) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3245 C. elegans C08G9.2(gk3191) ZK829.7(gk3253) IV; F25D1.3(gk3254) lact-8(gk3255) V. Show Description
This strain is homozygous for a deletion (gk3191) in C08G9.2, detectable by PCR using the following primers. External left primer: TCACAAGTTGGTACTGGGAGG. External right primer: CCATGCGAATTTTTGAACTGT. Internal left primer: ACAAGACCGTATGGGCAAAG. Internal right primer: ACCAATTTCATCTTGCCCTG. Internal WT amplicon: 1980 bp. Deletion size: 465 bp. Deletion left flank: CATTTCAAAAATCCATGGCAATCCGAATCT. Deletion right flank: ATCACCGTATCCACTGTTTTTGCAATGGTA. Validation: gk3191 passed by CGH. Other deletions (gk3253, gk3254, gk3255) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3246 C. elegans R06F6.6(gk3166) II; F53H8.3(gk3256) C41A3.1(gk3257) X. Show Description
This strain is homozygous for a deletion (gk3166) in R06F6.6, detectable by PCR using the following primers. External left primer: CGGGGAAATTATGAAAGCATTA. External right primer: TGCCAGCATAAAATTCAAAATG. Internal left primer: CGATGAAAATGTTCGGGATTAT. Internal right primer: AGCACAGAACAGGGACAAAAAT. Internal WT amplicon: 1384 bp. Deletion size: 892 bp. Deletion left flank: TCTTCCAGCAATGACTCCAACGCCGATTAT. Deletion right flank: TTTGGAATTTTTTTTGTCTGCTGACAAAAT. Insertion Sequence: T. Validation: gk3166 passed by CGH. Other deletions (gk3256, gk3257) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3247 C. elegans dlc-5(gk3510) IV; K09C6.7(gk3297) V. Show Description
This strain is homozygous for a deletion (gk3297) in K09C6.7, detectable by PCR using the following primers. External left primer: GGCGGTGGTCCAGTAAACTA. External right primer: GCTCGGTTTTACGGAATTGA. Internal left primer: GTTGACGCCTCGACATGTAA. Internal right primer: CAGGAACGTTGCCAGGTAAT. Internal WT amplicon: 2481 bp. Deletion size: 2123 bp. Deletion left flank: GAAATGTTGACGCCTCGACATGTAAGTGTT. Deletion right flank: TTTTCAAAATTTCTACATTTCTGTACTAAT. Insertion Sequence: T. Validation: gk3297 passed by CGH. Other deletion (gk3510) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3249 C. elegans mec-3(gk3299) IV. Show Description
F01D4.6. External left primer: CGCGTTGAAGTCAGTTGTGT. External right primer: GACTCCTGTTGGATTGGCAT. Internal left primer: CTGCCACATCAGTGTTGCTT. Internal right primer: CAAAGCCTCTCAGTGCGATT. Internal WT amplicon: 2450 bp. Deletion size: 1104 bp. Deletion left flank: TCCATAAGCGTCAACCTCCTAAAAATTAAA. Deletion right flank: ATAAAATGAGATTGGAAAATAGAATGAATA. Insertion Sequence: AAAATAAAAA. Validation: gk3299 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3256 C. elegans F40H3.2(gk3266) II; gkDf40 atf-7(gk3265) III. Show Description
This strain is homozygous for a deletion (gk3265) in F40H3.2, detectable by PCR using the following primers. External left primer: TTCCATTCGTGTTTCGATGA. External right primer: AGTTATCCCCACCGCTTTTT. Internal left primer: AACCGGAAAAATTCCAAACC. Internal right primer: CTTCTTCGCCGTTTCACTTC. Internal WT amplicon: 2013 bp. Deletion size: 819 bp. Deletion left flank: GAGCCGAGAAGTCACCGGCCTGAAAACGTT. Deletion right flank: GCTAGAGGAGCAGCAGCAATACAGCTCATC. Validation: gk3265 passed by CGH. Other deletions (gkDf40, gk3266) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3258 C. elegans hmr-1(gk3258) I; F38B7.12(gk3200) V; gkDf38 X. Show Description
This strain is homozygous for a deletion (gk3200) in F38B7.1, detectable by PCR using the following primers. External left primer: TTTATCAGGCAATCCCAACC. External right primer: CGTATGCCCTCATGTTTGTG. Internal left primer: AGTTCGAACAGCTGCCAAAT. Internal right primer: GCGACAAAGCCAATTAGTCC. Internal WT amplicon: 1490 bp. Deletion size: 540 bp. Deletion left flank: TCCAAGAATTTCAATGTATACTTCTCACAT. Deletion right flank: CCACTTTCAACCGTCGAAACAAAGGGATTC. Validation: No CGH probes for gk3200. Other deletions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3263 C. elegans zip-3(gk3164) II; str-260(gk3267) gkDf41 V. Show Description
This strain is homozygous for a deletion (gk3164) in W07G1.3, detectable by PCR using the following primers. External left primer: CAGGCTGATCCATTACGGTT. External right primer: TTCCCTGTCTCCAAAAATGC. Internal left primer: CGTATCAACTGGAATCGGGT. Internal right primer: GCTCCGAGCTCTCCCTATTT. Internal WT amplicon: 2525 bp. Deletion size: 1275 bp. Deletion left flank: AGTGTTTCAATTCGGCTTGATCTACGTAGA. Deletion right flank: ATGAATAGACCACGACCATTTTCTGGGCGG. Validation: gk3164 passed by CGH. Other deletions (gk3267, gkDf41) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3280 C. elegans F15A4.5(gk3259) II; flp-5(gk3123) X. Show Description
This strain is homozygous for a deletion (gk3123) in C03G5.7, detectable by PCR using the following primers. External left primer: CCTTCTATTCCCCCAGAGGCTTAC. External right primer: CGTTTGTCACCACTTCCCTATCC. Internal left primer: GGGTCGTGTGACGAATTGCGC. Internal right primer: AACCGTAATAGAAGACAGGGAGGTG. Internal WT amplicon: 3658 bp. Deletion size: 1513 bp. Deletion left flank: ACAGAAAAAAAAACACAAAAAACCAAAACT. Deletion right flank: TGGGTTAGTATTTCAAGAAAATAATTTTTT. Validation: gk3123 passed by CGH. Other deletion (gk3259) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3297 C. elegans gkDf44 IV; T04F3.1(gk3282) C14C10.4(gk3281) V. Show Description
This strain is homozygous for a deletion (gk3281) in C14C10.4, detectable by PCR using the following primers. External left primer: TAACTCATTAACGTCGGTGGC. External right primer: TGTGTAATTACCGTACCCGGA. Internal left primer: CATCAGATCAAGGGCTGGTAA. Internal right primer: GGGTTAAGTAGAAACGGCCTG. Internal WT amplicon: 1785 bp. Deletion size: 540 bp. Deletion left flank: GCGTTTCTCTTGTTGATGGAGCAAACATAA. Deletion right flank: AGATTAAAAGCATCAAATTGTCCATTTTCA. Insertion Sequence: ATTTTGCAAAC. Validation: gk3281 passed by CGH. Other deletions (gkDf44, gk3282) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3317 C. elegans +/II; gly-5(gk3278)/mT1 [dpy-10(e128)] III. Show Description
Apparent homozygous lethal deletion chromosome (gk3278 in Y39E4B.12) balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk3278 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GAAAAGGCAAAATACGACAAGG. External right primer: AATCGCGAAAAATTTCCAGTAA. Internal left primer: CAAAAATGTTGTCGATTTACGAAG. Internal right primer: CTTTTCTTACCAAGCATCGAATTT. Internal WT amplicon: 1049 bp. Deletion size: 581 bp. Deletion left flank: TCTGTACAAAAAAGCATTTTTTCTGCAAAA. Deletion right flank: AATGGAAGGTAAAAATTAAATTTTCGACCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3430 C. elegans ceh-99(gk3279) II. Show Description
ceh-99. Homozygous viable deletion. External left primer: TGGATATCTTTTTGGCCAGC. External right primer: GCCTTGAAATGTTCCGTTGT. Internal left primer: AGGGCTCAATGAGAAGCAAA. Internal right primer: AATCCCTGTCTCCTCGGTTT. Internal WT amplicon: 1484 bp. Deletion size: 496 bp. Left flanking sequence: TGAAGAGCCACGATCTCCGAGTATTGAGGT. Right flanking sequence: AATGGCTAGTGTGGAGGAAGTAAAAGTAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC699 C. elegans baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
B0464.7 Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk324 homozygotes (sterile loopy Unc, sometimes with withered tail). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC734 C. elegans fbxb-66(gk320) I. Show Description
Y40B1B.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC736 C. elegans gfl-1(gk321) IV. Show Description
M04B2.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC738 C. elegans tbc-12(gk328) X. Show Description
R11B5.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC740 C. elegans F20D1(gk323) X. Show Description
F20D1. Superficially wild type; affects pseudogene. External left primer: GGTATGACCAGCAAGACCGT. External right primer: CGTACATTGATGCTCGGTTG. Internal left primer: TGGGACAAAGACCATTCACA. Internal right primer: TTGTTTGGGATGTTGGAGGT. Internal WT amplicon: 1634 bp. Deletion size: 806 bp. Deletion left flank: CTTTACAGTGAATTATATTGCTCATGAAAC. Deletion right flank: CTCTCTATTCTTGAGTGAACCCAAATCAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC743 C. elegans cyp-35A2(gk326) V. Show Description
C03G6.15. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC747 C. elegans lagr-1(gk327) I. Show Description
Y6B3B.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC748 C. elegans pacs-1(gk325) V. Show Description
T18H9.7a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC766 C. elegans ceh-39(gk329) X. Show Description
T26C11.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC816 C. elegans ric-4(gk322) V. Show Description
Y22F5A.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807