Y22F5A.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1067) in F09B12.2, detectable by PCR using the following primers. External left primer: TGGTGGAGGTTTTCAAGGAG. External right primer: GCGTCATGGTGGGTAAAATC. Internal left primer: AAAGTGAACAGCGAAACGGT. Internal right primer: TAACTGGCAGCAGTGGTGAG. Internal WT amplicon: 1907 bp. Deletion size: 502 bp. Deletion left flank: TATAAGCCTGGCTGAAAGTTACGAATTTGG. Deletion right flank: AAAATTTGAATGAAATGTAAAGTTGAAGTA. Validation: gk1067 passed by diagnostic PCR, CGH. Other deletion (gk3221) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3176) in T26A8.4, detectable by PCR using the following primers. External left primer: TGCTTTGGCTCTTCTTGGAT. External right primer: TGTTTGCGCTGAGAGAGAGA. Internal left primer: GCTGAACTAATCCAGGCTGC. Internal right primer: TCCAACGTTCAAGATTCCAA. Internal WT amplicon: 1977 bp. Deletion size: approximately 625 bp. Validation: gk3176 passed by CGH. Left deleted probe: TTGCGGTGGCTGAACTAATCCAGGCTGCTGAAGATGTGGATGTTGAATTG. Right deleted probe: AAACTAACCTTTTTACAAAAACTATTAGCATAAAAGTTGCACAGAACAGG. Other deletions (gk3219, gk3220) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK185.1. Homozygous viable deletion, detectable by nested PCR. External left primer: TCCAAGTCAGCGCCTCTTAT. External right primer: AATTCAGCGAAAATGATCCG. Internal left primer: TTGGCGATGAACGTACCATA. Internal right primer: AATCGTGTAGCTGGTGGAGG. Internal WT amplicon: 1766 bp. Deletion size: 472 bp. Deletion left flank: TTCACAAAAAGTTAGATAAAAAGGTTGTGC. Deletion right flank: CAGCTAGTTTTTGTGCATTTTCTCAGATGT. Insertion sequence at break: GGCTAGTTTTTGTG. Validation: gk3229 confirmed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1105) in T22E7.2, detectable by PCR using the following primers. External left primer: GAAGGTGTGAAAAGACGGGA. External right primer: TGCAGGAAAAGCAACAAGAA. Internal left primer: TGGTCTGTAGAGCCCATTCA. Internal right primer: GTGTTGGAGAAACGTGGGAT. Internal WT amplicon: 2319 bp. Deletion size: 568 bp. Deletion left flank: TGATATTTTACTGATAATTATACACTTTCA. Deletion right flank: CTTCAAACATACGCTTCATCTTTTCGCGAA. Validation: No CGH probes for gk1105. Other deletions (gk3222, gkDf33) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1211) in T01D3.2, detectable by PCR using the following primers. External left primer: GTGAAGCCGAAGGATCATGT. External right primer: CGTCTTTGCTTTCTTTTCCG. Internal left primer: GAAGAACTTTGCATCGAGGG. Internal right primer: TGTCCAACAATTTCCAACGA. Internal WT amplicon: 1737 bp. Deletion size: 301 bp. Deletion left flank: TTAAAAAACAGAAAAAAAATTAAAAATATA. Deletion right flank: CATCTCCGCGCCTGTCCAGTATCACAAAGA. Validation: gk1211 passed by CGH. Other deletions (gk3223, gk3224) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807