More Fields
Strain Species Genotype
RB2471 C. elegans dsl-3(ok3411) IV. Show Description
Y41D4B.10 Homozygous. Outer Left Sequence: gcaaattcggcaaatctctt. Outer Right Sequence: atacccctttccaaaaaccg. Inner Left Sequence: ttgccgtgcttaacaaactc. Inner Right Sequence: atgaagtcacaggtgacaaaaa. Inner Primer PCR Length: 1353. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1232 C. elegans nhr-122(gk560) IV. Show Description
Y41D4B.9. External left primer: AACGAGGTCTCGACTGTGCT. External right primer: CTTTTCCTTTTCTACCCCCG. Internal left primer: ATTCGGAAAGAATTTGCACG. Internal right primer: TTTCAGTCTGGGATGGGTTT. Internal WT amplicon: 2011 bp. Deletion size: 1537 bp. Deletion left flank: AGAATATTGTTTGTCTGTCCGTTTTTTTTT. Deletion right flank: AGCTGCTCTAAAATCTCCTTGCAGAAAATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1758 C. elegans nhr-287(gk1014) IV. Show Description
Y41D4B.20. External left primer: TCTCGTTGCTTCCAAGTGTG. External right primer: AGGTGGCTATTTCGCATGTC. Internal left primer: TGTTGGACGATATGGAGCTG. Internal right primer: CAGCCAATTTCCGAGGTAGA. Internal WT amplicon: 2357 bp. Deletion size: 1043 bp. Deletion left flank: TTTCTTTGTACAAAAACCATCACCAGCCTC. Deletion right flank: GAAATTTTGAACATCGAACCAACTATCCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1813 C. elegans nhr-287(gk866) IV. Show Description
Y41D4B.20. External left primer: TCTCGTTGCTTCCAAGTGTG. External right primer: AGGTGGCTATTTCGCATGTC. Internal left primer: TGTTGGACGATATGGAGCTG. Internal right primer: CAGCCAATTTCCGAGGTAGA. Internal WT amplicon: 2357 bp. Deletion size: 879 bp. Deletion left flank: TCCAGCCCCGAGAAAGCCTAAACTTAAGTA. Deletion right flank: TTTTTTGGGTATGTTCTTTTTGGACCCCCATAACTTTTTTGAGAACAAGTTTCAGATAA TTTTTTTTCGATGAAATTTTAGTCAAATACTTGATTAACATTATCTCCATAAAAAATCA TATTAATAGCTCGTTGGCGCCGTGGGCTGGAACGCGAAAAAAACTTCCCATAATTAATT GTCACCCTGTATATGTATATATGTAATCATATGCACGTATATGTATAATTGATATGTAA TAGATATGTATAACCTATATGTATATAGTAATACATATGTTCAAAACCTAGTAGTATTA TATAAACCTAGTATAGAATATTACCATAACTAGTACCTACCTATGTATATGTATAAAAT ATGATGCCATGATCAGACTGAATGGTAGGTTAATCATCAATCAAAAAATTACTTCAAAA TAATACCCCGGTTTCAGTTATACACCATAACGCCGAATTCAGTAAGCCTATTGTTGGTT TTCGGTAGTTAGTGAATAAACTTATTATTATTATTATTATTATTTGGGTGTATATCTTA TATCATACTATTTTATACATGTTCTTATTAAGGAAAAGGTTTATTTCGTTGCACCTCTG ATTACGGCTCAAAAACCTACCTGTAAATTCGGTAGGATTGACAATATATCCCCTAGTCG AATTGACGAATCTAATTCTGATCTCGTCAGCTTGGAGTACTGTAGAACTTCCCGCTGCA CGGATTCCCGAATCCTTCTGCATGATTCTGTGCATTGATCGGACTGGCCTTCTAGCCCC GTGTCGAATAGAGTTAAGGCTGTTAGAGCCAGAAATTCGAATTTGTCACACGCAATTCG GATCATTGGATCGTACACATTGCGGCGGTAAGTGTCGAATGAGCTGGCGAACATTCTGG AAAATTTTTTAAATCGGCAAAGATATTTGAATAGATTCCTACTTGGAAGCTTCTACCTC GGAAATTGGCTGTTGTCCATCTGGATCGTGATAATACGTTTCTGGATTCACACAATCAA TATAATCACCAGATGGTAGGTAGGTAATGTCTGTTCTGCCATATTGACATGCGAAATAG CCACCTTCGAGGATGATGAATTGTAGGTAGAAGTTGTGGAGCAGGGTTGTCTGAAAGAA TTCGAGGTATGGACTTTGGACAGGGTAAGCATTCTTGGACAGACTCTAAGCAGGCTTTT GCCAAATAACGAGCAGAACTTTACTCGACCAGGCTGGGAAAGATTTGGACCAGAATTGG TCCTGATATTGTTCAACTCTTCGCTTGGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2027 C. elegans nhr-87(gk1283) IV. Show Description
Y41D4B.7. External left primer: GAAACCACAAATTACCCCCA. External right primer: AACCACATTTCGGCTGTTTC. Internal left primer: CACTTCATAGTGTGGGCGTG. Internal right primer: AGGATTCCGATTGACCTTCC. Internal WT amplicon: 2253 bp. Deletion size: 1371 bp. Deletion left flank: AAGTGACGTCACACTTCATAGTGTGGGCGT. Deletion right flank: ATAACTTACAGAGTGATGAAAGGAACGTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2975 C. elegans bath-5(gk3138) II; Y41D4B.26(gk1259) IV; unc-83(gk3139) V. Show Description
W01A11.3, Y41D4B.26, F07E5.7. The gk1259 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: AGAGTTCGGGGCTGATTTTT. External right primer: AGGAGGGACTTTTTAGGCCA. Internal left primer: AACTGAGCCACTCGGGTAAA. Internal right primer: TGCTGATTGGAAGAAGTGGA. Internal WT amplicon: 2165 bp. Deletion size: 1624 bp. Deletion left flank: CTGAGCCACTCGGGTAAAACTAAATTTTTT. Deletion right flank: ATTTTTTTCTAGAAACTGGACCGGCGAAAA. Insertion Sequence: CCCTTTCCCCCC. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3195 C. elegans oig-1(gk3204) III; Y41D4B(gk3099) IV; pqn-11(gk3205) X. Show Description
This strain is homozygous for a deletion (gk3099) in Y41D4B, detectable by PCR using the following primers. External left primer: GAAACGTTGGAAAAACGGAA. External right primer: CTTTGTTCGCTGCGTAATGA. Internal left primer: CAATTTCCATACCCTCGCTC. Internal right primer: CGCACACAAGCCTTAACTCA. Internal WT amplicon: 1594 bp. Deletion size: 191 bp. Deletion left flank: GGAAACTGTGTGTTTCTGAAAATAGAGGTT. Deletion right flank: GACCACCCCAAGTGTCCTAACTCGGAGCCA. Insertion Sequence: AAAA. Validation: No CGH probes for gk3099. Other deletions (gk3204, gk3205) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3243 C. elegans nhr-274(gk3116) IV; gkDf36 V; gkDf37 X. Show Description
This strain is homozygous for a deletion (gk3116) in Y41D4B.21, detectable by PCR using the following primers. External left primer: GAAACGTTGGAAAAACGGAA. External right primer: CTTTGTTCGCTGCGTAATGA. Internal left primer: CAATTTCCATACCCTCGCTC. Internal right primer: CGCACACAAGCCTTAACTCA. Internal WT amplicon: 1594 bp. Deletion size: 444 bp. Deletion left flank: ACCTCATTAGTGACAGCTCTTCGAAAGAAT. Deletion right flank: CAATTTTTTCAGACATTTTTCTGATCTCGT. Insertion Sequence: AAA. Validation: No CGH probes for gk3116. Other deletions (gkDf36, gkDf37) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3265 C. elegans nhr-92(gk3168) IV. Show Description
This strain is homozygous for a deletion (gk3168) in Y41D4B.8, detectable by PCR using the following primers. External left primer: CTTTTTCAGGCCAATTCCAA. External right primer: TCGTTGCACCTCTGATTACG. Internal left primer: CGGAGTCGTTTGCAGGTATT. Internal right primer: TGGAAGCTTCTACCTCGGAA. Internal WT amplicon: 1944 bp. Deletion size: 626 bp. Deletion left flank: AAAGTTCTTCTCAAAGAGTTTAAGCTTGTT. Deletion right flank: CAGACATTACCTACCTACCATCTGGTGATT. Insertion Sequence: GT. Validation: gk3168 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807