Strain Information

Name RG3592   View On Wormbase
Species C. elegans
Genotypetpxl-1(ve1092[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V.
DescriptionumnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Sterile. Deletion of 1411 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Sterile GFP+ non-mKate2 (ve1092 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: GTGAAGTCCTCGTTGGCGTAGCAGTAACCT; Right flanking sequence: CTGCTGAAGAAATTCTCATCGAATTCCTGA. tpxl-1 sgRNA #1: CAACAGACTTGCCACACCAA; tpxl-1 sgRNA #2: CTTTGCTGTACCGAAAGTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
MutagenCrispr/Cas9
Made byRG KO Group
Laboratory RG
Reference n/a
Sign in or register an account if you want to order this strain.