Species Information: C. elegans

Name C. elegans
NCBI Taxonomy ID

C. elegans strains available at the CGC

Strain Genotype Description
CGC73 npr-28(umn6[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Homozygous viable. Deletion of 842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TATTTGGTATCATTTTTCTAGCCGACTTTC ; Right flanking sequence: TGGACTTGTTTTCACTCATCCCTGTACCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC68 mT1/unc-4(e120) II; mT1 [dpy-10(e128) umnIs54]/dpy-17(e164) III. umnIs54 [myo-2p::GFP + NeoR, III: 11755713 (intergenic)] II. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-mGFP, sterile Dpy GFP+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.
CGC67 umnIs53 V. umnIs53 [myo-2p::GFP + NeoR, V:18120303 (intergenic)] V. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
CGC69 dpy-18(e364)/eT1 [umnIs55] III; unc-46(e177)/eT1 V. umnIs55 [myo-2p::mKate2 + NeoR, V:1005689 (intergenic)] III. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, Unc-36 mKate+(eT1), dead eggs, and DpyUncs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
CGC71 unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 [umnIs57] V. umnIs57 [myo-2p::mKate2 + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
LP559 mom-2(cp267[mom-2::mNG-C1^3xFlag]) V. FP fusion. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP697 mom-5(cp367[mom-5::mNG-C1^3xFlag]) I. FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP184 mom-5(cp31[mom-5::YPET + LoxP]) I. FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP538 gsk-3(cp251[gsk-3::mNG-C1^3xFlag]) I. FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP228 dsh-2(cp51[mNeonGreen::dsh-2]) II. FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
OH15178 pals-22(ot810) III; otIs381 V. otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal nuclear GFP expression. pals-22(ot810) mutant shows transgene-silencing phenotype. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH15179 pals-22(ot811) III; otIs381 V otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. pals-22(ot811) mutant shows transgene-silencing phenotype. Pan-neuronal nuclear GFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH13606 otIs620. otIs620 [unc-11(prom8)::2xNLS::GFP]. Pan-neuronal nuclear GFP expression. Reference: Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH15144 pha-1(e2123) III; otEx7036. otEx7036 [pals-22p::GFP::unc-54 3'UTR + pha-1(+)]. Transcriptional reporter containing pals-22 promoter (coordinates -791 to -1 from start). Maintain at 25C to select for otEx7036. Reference: Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH15145 pha-1(e2123) III; otEx7037. otEx7037 [pals-22p::GFP::unc-54 3'UTR + pha-1(+)]. Translational reporter fusion containing pals-22 promoter (coordinates -791 to -1 from start). Maintain at 25C to select for otEx7037. Reference: Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH14420 pals-22(ot811) III; otIs381 V; otEx6761. otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal nuclear GFP expression. otEx6761 [pals-22(+) + ttx-3p::mChOPTI]; derived from PCR fragment containing the genomic pals-22 locus. pals-22(ot811) mutant shows transgene-silencing phenotype; otEx6761 rescues ot811 and restores otIs381 expression at wild-type levels. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH14429 pals-22(ot811) III; otIs381 V; otEx6769. otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal nuclear GFP expression. otEx6769 [pals-22(fosmid) + myo-2p::mChOPTI]; derived from NotI digestion of WRM0616DC09. pals-22(ot811) mutant shows transgene-silencing phenotype; otEx6769 rescues ot811 and restores otIs381 expression at wild-type levels. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OD2425 plk-1(lt18[plk-1::sGFP]::loxp) III. GFP inserted at the C terminus of plk-1 followed by LoxP generated by Cre-mediated excision of unc-119(+) cassette. Reference: Martino L. et al. Dev Cell. 2017 Oct. 23; 43(2):157-171.
OD923 ltSi240 II; unc-119(ed3) III. ltSi240 [csr-1p::csr-1(re-encoded) + Cbr-unc-119(+)] II. The csr-1 coding sequence in the transgene was re-encoded for RNAi-resistance (see Gerson-Gurwitz A, et al. Cell. 2016, Supplementary Figure S3A). Reference: Gerson-Gurwitz, et al. Cell. 2016 Apr 7;165(2):396-409.
OD925 ltSi242 II; unc-119(ed3) III. ltSi242 [csr-1p::csr-1(re-encoded; D606A, D681A: isoform b numbering) + Cbr-unc-119(+)] II. The csr-1 coding sequence in the transgene was re-encoded for RNAi-resistance (see Gerson-Gurwitz A, et al. Cell. 2016, Supplementary Figure S3A). Reference: Gerson-Gurwitz, et al. Cell. 2016 Apr 7;165(2):396-409.
CGC75 unc-13(e51)/hT1 [umnIs58] I; dpy-11(e224)/hT1 [unc-42(e270)] V. umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Pick wild-type mKate2+ to maintain. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, arrested hT1 homozygotes (mKate2+), and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
JK4832 gld-1(q485) gld-2(q497) lst-1(ok814) sygl-1(tm5040) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Pick GFP+ heterozygotes to maintain. Segregates fertile GFP+ heterozygotes, non-GFP homozygous mutants (Gld; form germline tumors), very rare GFP+ homozygous hT2, and dead eggs. Reference: Kershner et al. (2014) PNAS 111: 3739-3744.
JK5893 sygl-1(q983[3xOLLAS::sygl-1]) I. q983 is a 3xOLLAS::sygl-1 tagged endogenous locus. Superficially wild-type. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.
JK6002 sygl-1(q1015[sygl-1::V5]) I. q1015 is a sygl-1::V5 tagged endogenous locus. Superficially wild-type. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.
JK5929 lst-1(q1004[lst-1::V5]) I. q1004 is lst-1::V5 tagged endogenous locus. Superficially wild-type. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.
JK5964 lst-1(q1008[lst-1::3xOLLAS]) I. q1008 is lst-1::3xOLLAS tagged endogenous locus. Superficially wild-type. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.
JK5842 fbf-2(q932[3xV5::fbf-2]) II. q932 is 3xV5::fbf-2 tagged endogenous locus. Superficially wild-type. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.
JK4299 gld-2(q497) gld-1(q361) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Pick GFP+ heterozygotes to maintain. Segregates fertile GFP+ heterozygotes, non-GFP homozygous mutants (Gld; form germline tumors), very rare GFP+ homozygous hT2, and dead eggs. gld-1(q361) is a missense allele but phenotypically null, which allows the detection of gld-1 mRNA and protein by single molecule FISH or antibody staining. Reference: Hansen et al (2004) Dev. Biol. 2004;268(2):342-57. Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.
JK5760 lst-1(ok814) sygl-1(q828) gld-2(q497) gld-1(q361) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Pick GFP+ heterozygotes to maintain. Segregates fertile GFP+ heterozygotes, non-GFP homozygous mutants (Gld; form germline tumors), very rare GFP+ homozygous hT2, and dead eggs. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.
JK6070 lst-1(q826) I. Slightly smaller germline mitotic region than wild-type. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.
VT3297 maIs105 V; mir-793(ma292) X. maIs105 [col-19::GFP] V. mir-793(ma292) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma292 allele is missing the 220 nucleotide region between ACCGAGCAAGTTAGAAATCACCGCC and GTATGAATGTTTTTCCTTCAAACAT [chrX:13,857,855-13,858,124 of WBcel235/ce11].
RG3153 tni-3(ve653[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 1346 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: agcacataaaaatctacaaaaagatcacca ; Right flanking sequence: cctggaaaagttgatctgtgagaagtggca. sgRNA #1: GGAGGAAGAGGAATAAgaag; sgRNA #2: tttggcggggaaaaatgacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VT3301 mir-794 mir-795(maDf5) I. mir-794 mir-795(maDf5) enhances retarded phenotypes of mir-48 mir-241 (nDF51). maDf5 allele is missing the 1312 nucleotide region between ATACATATTCCGAGAAACGTTACCT and GTGAGGCGCCAAATGCCGGCCTCAC [chrI:12,594,556-12,595,917 of WBcel235/ce11].
CGC76 umnIs59 I. umnIs59 [myo-2p::mKate2 + NeoR, I:6284001(intergenic)] I. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.
CGC77 hT2 [umnIs60] I; hT2 [bli-4(e937)] III. umnIs60 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous-viable translocation marked with bli-4 and mKate2. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR1234 using CRISPR/Cas9.
CZ9236 juIs252 V. juIs252 [mec-4p::mCherry + ttx-3p::RFP] V. mCherry expression in touch neurons. Reference: Knowlton WM, et al. Front Neurosci. 2017 May 10;11:263. doi: 10.3389/fnins.2017.00263. Chuang M, et al. 2014 Cell Rep, 9, 874-83.
CGC78 C04C3.6(umn8[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
OH14364 pha-1(e2123) III; him-5(e1490) V; otEx6706. otEx6706 [srb-17p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14971 pha-1(e2123) III; him-5(e1490) V; otEx6964. otEx6964 [srbc-7p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13857 pha-1(e2123) III; otEx6421. otEx6421 [srd-4p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13859 pha-1(e2123 III; otEx6423. otEx6423 [srd-5p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13861 pha-1(e2123) III; otEx6425. otEx6425 [srd-10p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH13863 pha-1(e2123) III; otEx6427. otEx6427 [srd-11p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14368 pha-1(e2123) III; him-5(e1490) V; otEx6710. otEx6710 [srd-32p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14238 pha-1(e2123) III; him-5(e1490) V; otEx6614. otEx6614 [srg-4p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14240 pha-1(e2123) III; him-5(e1490) V; otEx6616. otEx6616 [srg-14p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14360 pha-1(e2123) III; him-5(e1490) V; otEx6702. otEx6702 [srg-25p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14241 pha-1(e2123) III; him-5(e1490) V; otEx6617. otEx6617 [srg-29p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14243 pha-1(e2123) III; him-5(e1490) V; otEx6619. otEx6619 [srg-31p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14244 pha-1(e2123) III; him-5(e1490) V; otEx6620. otEx6620 [srg-32p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.