| CB5495 |
bus-10 & ZK596.4 & ZK596.5(e2715) IV. |
Viable, Bus, resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. e2715 is a small deficiency (3191 bp) which removes all of the bus-10 exons and internal ncRNA genes ZK596.4 & ZK596.5. Reference: O'Rourke et al (in preparation). |
| CB5614 |
bus-5(e2701) X. |
Bus (M. nematophilum resistant), bleach-sensitive, non-Bah (Yersinia sensitive). e2701 is an intermediate strength missense allele, S167N (YAASKAA>YAANKAA). Reference: O'Rourke et al (in preparation). |
| CB6921 |
bus-10 & ZK596.4 & ZK596.5 & ZK596.1(e2737) IV. |
Viable, Bus (M. nematophilum resistant), resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. e2737 is a ~4.5 kb deficiency which removes all of the bus-10 exons, internal ncRNA genes ZK596.4 & ZK596.5, and ZK596.1. Reference: O'Rourke et al (in preparation). |
| CB6931 |
bus-10 & ZK596.4 & ZK596.5(e2715) IV; dhs-29(e3014) X. |
Bus, bleach-sensitive, resistant to Leucobacter Verde2 and Leucobacter Verde1. e2715 is a small deficiency (3191 bp) which removes all of the bus-10 exons and internal ncRNA genes ZK596.4 & ZK596.5. Reference: O'Rourke et al (in preparation). |
| CB7201 |
bah-2(gk487599) IV. |
Bah (resistant to bacterial Biofilm formation by Yersinia). Reference: O'Rourke et al (in preparation). |
| CB7471 |
unc-119(ed3) III; bus-8A(lj22) X; eEx861. |
eEx861 [bus-8(U1,2)::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. bus-8 exon U1 mutation rescued by small U1,2 transgene. lj22 is a missense mutation (R32C) in bus-8A and might also affect bus-8B (out-of-frame 5'exon U1). Reference: O'Rourke et al (in preparation). |
| CB7476 |
him-8(e1489) IV; galt-1(op497) V. |
Him. Resistant to fungal toxin CGL2; weakly resistant to Leucobacter Verde1. Him strain derived from pmk-1;galt-1 double mutant. References: Butschi et al (2010). O'Rourke et al (in preparation). |
| CB7492 |
bus-28(gk236264) V. |
Bus (M. nematophilum resistant), weakly resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. Reference: O'Rourke et al (in preparation). |
| CB7516 |
bus-10(e2702) IV; bus-28(gk236264) V. |
Viable, Bus (M. nematophilum resistant), resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. Reference: O'Rourke et al (in preparation). |
| CB7537 |
srf-2(e3137) I. |
Srf, Bus, Bah. Amber nonsense mutation: W125* (TIPFFCKW>TIPFFCK*). Reference: O'Rourke et al (in preparation). |
| CB7538 |
lon-2(e678) bus-8B(ok1176) X. |
Very slow-growing, grows best at 25C. Small, bleach-sensitive, Bus, resistant to Leucobacter Verde1. Reference: O'Rourke et al (in preparation). |
| CB6452 |
dpy-25(e817) II; xol-1(y9) X. |
Severe dumpy; dominant, hence crossing with wild-type males yields dumpy hermaphrodites and dead eggs (dpy-25/+; xol-1/0). |
| CB7148 |
him-5(e1490) V; bus-8B(tm1410) X; eEx763. |
eEx763 [bus-8(exonU2stop) + sur-5p::GFP]. Pick GFP+ to maintain. Lethal bus-8 mutation rescued by bus-8 transgene defective in 5' exons U1 and U2. Reference: Stroud et al (in preparation). |
| SX3073 |
mjIs588 II; unc-119(ed3) III |
mjIs588 [mex-5p::GFP::his-58::21UR-1target::tbb-2 3'UTR + unc-119(+)] II. mjIs588 was derived by removing introns 2 and 3 from the construct used to generate the mjIs144 transgene. Single copy inserted into ttTi5605 (MosSCI). Superficially wild-type. mjIs588 GFP is silenced in wild-type animals and de-silenced in hrde-1 mutant animals. Reference: Akay A, et al. Dev Cell. 2017 Aug 7;42(3):241-255.e6. |
| SX3117 |
emb-4(mjSi92[OLLAS::emb-4]) V. |
mjSi92[OLLAS::emb-4]. Endogenous emb-4 locus tagged with OLLAS epitope. No visible phenotype. Reference: Akay A, et al. Dev Cell. 2017 Aug 7;42(3):241-255.e6. |
| CGC61 |
F36D4.4(umn4[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. |
Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| CGC64 |
unc-30(e191) dpy-4(e1166) IV; yDp1 [umnIs50] (IV;V;f). |
umnIs50 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)]. Animals with the Dup are wild-type mKate2+; animals that have lost the Dup are Dpy Unc mKate2-. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into yDp1 duplication in parental strain TY156 using CRISPR/Cas9. |
| CGC65 |
mT1/unc-4(e120) II; mT1 [dpy-10(e128) umnIs51]/dpy-17(e164) III. |
umnIs51 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] III. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9. |
| CGC63 |
unc-5(e53)/nT1 [umnIs49] IV; dpy-11(e224)/nT1 V. |
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9. |
| DCD214 |
uqIs24. |
uqIs24 [myo-2p::tagRFP::pab-1]. Expression of tagRFP::PAB-1 in pharyngeal muscles; assembles into stress granules after heat shock (2 hr at 32C) and forms tagRFP::PAB-1 aggregates with age at 20C. Valuable marker for aging and for studying the aggregation of RNA-binding proteins with prion-like domains. Reference: Lechler MC, et al. Cell Rep. 2017 Jan 10;18(2):454-467. |
| TG4100 |
vtIs1 V; glit-1(gt1981) X. |
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll obviously. gt1981 is a point mutation in a highly conserved residue. Hypersensitive to oxidative stress: Increased dopaminergic neurodegeneration after 6-OHDA exposure and increased developmental delay after exposure to rotenone and paraquat. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/203067. |
| TG4103 |
ttr-33(gt1983) vtIs1 V. |
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll obviously. Hypersensitive to oxidative stress: Increased dopaminergic neurodegeneration after 6-OHDA exposure and increased developmental delay after exposure to rotenone and paraquat. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/198606. |
| TG4094 |
unc-119(ed3) III; cxTi10816 IV; otIs433 V; gtEx4094. |
otIs433 [dat-1::NLS::RFP + ttx-3::mCherry] V. gtEx4094 [glit-1p::GFP::glit-1 3'UTR + myo-3p::mCherry]. Pick animals with red fluorescence in body muscles to maintain. Transcriptional glit-1 reporter. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/203067. |
| TG4281 |
unc-119(ed3) III; cxTi10816 IV; gtEx4170. |
gtEx4170 [ttr-33p::GFP::ttr-33 3'UTR + myo-2p::mCherry + myo-3p::mCherry]. Pick mCherry+ animals to maintain. Transcriptional ttr-33 reporter. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/198606. |
| AQ3236 |
ljSi2 II; unc-119(ed3) III. |
ljSi2 [mec-7::GCaMP6m::SL2::TagRFP + unc-119(+)] II. GCaMP6m (13.693) and RFP expressed in touch receptor neurons (ALML/R, AVM, PVM, PLML/R). Dual expression of GCamp6m and RFP allows for ratio-metric corrections of motion artifacts. Reference: Cho Y, et al. Lab Chip. 2017 Jul 25;17(15):2609-2618. |
| HC970 |
sid-1(qt78) V. |
Sid. Deletion allele. Reference: Whangbo JS, et al. G3 (Bethesda). 2017 Oct 12 [Epub ahead of print]. pii: g3.300308.2017. doi: 10.1534/g3.117.300308. PMID: 29025917. |
| MJF1 |
chpIR1 (M, CB4856 > N2). |
Reduced lifespan and reduced mitochondrial membrane potential. Transmitochondrial cybrid worm strain was bred to be homoplasmic for the CB4856 mtDNA genome in the N2 nuclear background. Reference: Dingley SD, et al. J Mol Biol. 2014 May 29;426(11):2199-216. |
| ML2501 |
let-805(mc73[let-805::gfp + unc-119(+)]) unc-119(ed3) III. |
Superficially wild-type. mc73 was generated by using Crispr/Cas9 to add a GFP tag to the endogenous let-805 locus and also insert a rescuing unc-119 transgene. Reference: Quentin S, et al. Development 2016 143: 160-173; doi: 10.1242/dev.126615. |
| DG4454 |
npp-12(ok2424) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III) |
Homozygous ok2424 animal are viable and fertile, but will go sterile in successive generations. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2424 homozygotes (superficially wild-type with some sterility). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Derived from parental strain RB1874, originally provided to the CGC by the OMRF Knockout Group, part of the International C. elegans Gene Knockout Consortium. Paper_evidence WBPaper00041807 |
| FT1459 |
unc-119(ed3); xnIs506. |
xnIs506 [cdc42p::GST::GFP::wsp-1(GBD) + unc-119(+)]. Biosensor for active CDC-42. In epithelia, GFP is enriched at junctions between epithelial cells. Some signal is in the nucleus (this signal is reduced by addition of GST, which makes the transgenic protein larger). Reference: Zilberman, Y., J. Abrams, D.C. Anderson, and J. Nance. 2017. Cdc42 regulates junctional actin but not cell polarization in the Caenorhabditis elegans epidermis. J Cell Biol 216: 3729-3744. |
| FT1197 |
unc-119(ed3); xnIs449. |
xnIs449 [lin-26::lifeAct::GFP + unc-119(+)]. LifeAct-GFP expressed in epidermal cells of embryos. In adults, expression is also observed in pharynx and some cells in the tail. Reference: Zilberman, Y., J. Abrams, D.C. Anderson, and J. Nance. 2017. Cdc42 regulates junctional actin but not cell polarization in the Caenorhabditis elegans epidermis. J Cell Biol 216: 3729-3744. |
| FT575 |
unc-119(ed3); xnIs243. |
xnIs243 [picc-1p::picc-1::GFP + unc-119(+)]. Weak maternal expression visible at early embryo cell contacts. Stronger zygotic expression visible at junctions of epithelial cells. Transgene generated from a recombineered genomic fosmid clone. Reference: Zilberman, Y., J. Abrams, D.C. Anderson, and J. Nance. 2017. Cdc42 regulates junctional actin but not cell polarization in the Caenorhabditis elegans epidermis. J Cell Biol 216: 3729-3744. |
| SRU1 |
unc-119(ed3) III; jrsls1. |
jrsls1 [cyp-13A7p::GFP + unc-119(+)]. CYP-13A7 is the homolog of human cytochrome P450 CYP3A4, which is the major inducible xenobiotic (more than 50% of the current drugs induce its expression which adversely affect the bioavailability and half-life of the drugs). |
| CZ5261 |
juIs198 V. |
juIs198 [unc-25p::YFP::rab-5 + ttx-3p::RFP] V. YFP-labeled RAB-5 synaptic vesicles in GABAergic motor neurons. Reference: Sann SB, Crane MM, Lu H, Jin Y. PLoS One. 2012;7(6):e37930. |
| EGD224 |
egxSi100 II; unc-119(ed3) III. |
egxSi100 [mex-5p::GFP::pos-1 + unc-119(+)] II. Single-copy transgene expressing GFP::POS-1. Reference: Han et al, Current Biology 2017. |
| EGD263 |
egxSi100 II; unc-119(ed3) III; mex-5(egx1[F294N & F339N]) IV. |
egxSi100 [mex-5p::GFP::pos-1 + unc-119(+)] II. Single-copy transgene expressing GFP::POS-1. mex-5(egx1[F294N, F339N]) modifies the endogenous mex-5 locus to disrupt zinc finger motifs. Reference: Han et al, Current Biology 2017. |
| EGD175 |
pie-1(ne4301[pie-1::gfp]) III; mex-5(egx1[F294N & F339N]) IV. |
pie-1(ne4301) inserted GFP into pie-1 locus tagging endogenous pie-1 with GFP. mex-5(egx1[F294N, F339N]) modifies the endogenous mex-5 locus to disrupt zinc finger motifs. Reference: Han et al, Current Biology 2017. |
| EGD226 |
egxSi101 II; unc-119(ed3) III. |
egxSi101 [mex-5p::GFP::pos-1(F121N & F164N) + unc-119(+)] II. Single-copy transgene expressing mutated POS-1 with GFP tag. GFP::POS-1 is uniformly distributed in the one-cell zygote. Reference: Han et al, Current Biology 2017. |
| EGD271 |
egxSi109 II; unc-119(ed3) III. |
egxSi109 [mex-5p::GFP::pos-1(S199A, S210A, S216A, S237A & T242A) + unc-119(+)] II. Single-copy transgene expressing mutated POS-1 with GFP tag. GFP::POS-1 is uniformly distributed in the cytoplasm of the one-cell zygote. Reference: Han et al, Current Biology 2017. |
| EGD273 |
egxSi110 II; unc-119(ed3) III. |
egxSi110 [mex-5p::GFP::pos-1(S199D, S210D, S216D, S237D & T242D) + unc-119(+)] II. Single-copy transgene expressing mutated POS-1 with GFP tag. GFP::POS-1 is uniformly distributed in the cytoplasm of the one-cell zygote. Reference: Han et al, Current Biology 2017. |
| EGD275 |
egxSi116 II; unc-119(ed3) III |
egxSi116 [mex-5p::GFP::mex-5(F294N, F339N) + unc-119(+)] II. Modified MEX-5::GFP forms a much weaker gradient in the cytoplasm of the one-cell zygote than wild type. Reference: Han et al, Current Biology 2017. |
| EGD282 |
egxSi100 II; unc-119(ed3) III; mex-5(egx2[T186A]) IV. |
egxSi100 [mex-5p::GFP::pos-1 + unc-119(+)] II. Single-copy transgene expressing GFP::POS-1 forms a weaker gradient in the cytoplasm of the one-cell zygote than in wild-type. Reference: Han et al, Current Biology 2017. |
| EGD199 |
mex-5(egx1[F294N, F339N]) IV. |
mex-5(egx1[F294N, F339N]) modifies the endogenous mex-5 locus to disrupt zinc finger motifs. Reference: Han et al, Current Biology 2017. |
| EGD334 |
egxSi100 II; plk-1(egx3[C52V, L115G]); unc-119(ed3) III. |
egxSi100 [mex-5p::GFP::pos-1 + unc-119(+)] II. Single-copy transgene expressing GFP::POS-1. Reference: Han et al, Current Biology 2017. |
| ERT60 |
jyIs13 II. |
jyIs13 [act-5p::GFP::ACT-5 + rol-6(su1006)] II. Rollers with GFP localized to apical side of intestine. Reference: Szumowski SC, et al. Cell Microbiol. 2015 Jul 6. PMID:26147591. |
| ERT54 |
jyIs8 X. |
jyIs8 [pals-5p::GFP + myo-2p::mCherry] X. GFP expression induced in the intestine after intracellular infection or proteasomal inhibition. Reference: Bakowski MA, et al. PLoS Pathog. 2014 Jun 19;10(6):e1004200. |
| CYA1 |
rexIs1. |
rexIs1 [hsp-16p::halo::TEV::Keap1 + mec-7p::mRFP]. Constitutive red fluorescence in touch-receptor neurons. Heat-shock promoter drives expression of Halo protein with TEV recognition site for the tobacco etch virus protease and human Keap1 protein (an established RES sensor). No phenotypic change upon heat-shock (37°C). Integrated into N2 background; insertion site not known. Reference: Long MJC, et al. Biochemistry. 2017 Sep 12. doi: 10.1021/acs.biochem.7b00642. |
| CYA2 |
rexIs2. |
rexIs2 [hsp-16p::tom70::mCherry::halo + mec-7p::mRFP]. Array is prone to silencing; pick RFP animals to maintain array. Constitutive red fluorescence in touch-receptor neurons. Heat-shock promoter drives expression of mCherry with tom70 (outer mitochondrial membrane targeting sequence from yeast) and Halo protein. Global red fluorescence upon heat-shock (37°C). Integrated into N2 background; insertion site not known. Reference: Long MJC, et al. Biochemistry. 2017 Sep 12. doi: 10.1021/acs.biochem.7b00642. |
| CGC66 |
unc-4(e120)/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/dpy-17(e164) III. |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9. |
| CGC72 |
npr-23(umn5[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. |
Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |